ID: 1150306584

View in Genome Browser
Species Human (GRCh38)
Location 17:64090667-64090689
Sequence AGCGTGGATCTCAGCTCCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 69}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150306584_1150306587 4 Left 1150306584 17:64090667-64090689 CCATCGGAGCTGAGATCCACGCT 0: 1
1: 0
2: 0
3: 1
4: 69
Right 1150306587 17:64090694-64090716 CGTGTGTGGCAGCTGCTAAGAGG 0: 1
1: 0
2: 0
3: 11
4: 103
1150306584_1150306585 -10 Left 1150306584 17:64090667-64090689 CCATCGGAGCTGAGATCCACGCT 0: 1
1: 0
2: 0
3: 1
4: 69
Right 1150306585 17:64090680-64090702 GATCCACGCTACTACGTGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150306584 Original CRISPR AGCGTGGATCTCAGCTCCGA TGG (reversed) Intronic