ID: 1150306584

View in Genome Browser
Species Human (GRCh38)
Location 17:64090667-64090689
Sequence AGCGTGGATCTCAGCTCCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 69}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150306584_1150306585 -10 Left 1150306584 17:64090667-64090689 CCATCGGAGCTGAGATCCACGCT 0: 1
1: 0
2: 0
3: 1
4: 69
Right 1150306585 17:64090680-64090702 GATCCACGCTACTACGTGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 26
1150306584_1150306587 4 Left 1150306584 17:64090667-64090689 CCATCGGAGCTGAGATCCACGCT 0: 1
1: 0
2: 0
3: 1
4: 69
Right 1150306587 17:64090694-64090716 CGTGTGTGGCAGCTGCTAAGAGG 0: 1
1: 0
2: 0
3: 11
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150306584 Original CRISPR AGCGTGGATCTCAGCTCCGA TGG (reversed) Intronic
908599613 1:65724799-65724821 AGCGTGGATCATAGCTGAGATGG - Intergenic
912876290 1:113363125-113363147 TTCGAGGCTCTCAGCTCCGAAGG + Intergenic
916702989 1:167317473-167317495 TTCGTGGCTCTCAGCTCTGAAGG - Intronic
922887194 1:229029181-229029203 AGGCTGGAGCTCAGCTCAGAAGG + Intergenic
923865442 1:237934375-237934397 TTCGTGGCTCTCAGCTCTGAAGG - Intergenic
1066655991 10:37700595-37700617 AGGGTGGGACTCAGCTGCGAAGG - Intergenic
1066988172 10:42486894-42486916 TTCGTGGCTCTCAGCTCTGAAGG + Intergenic
1069111601 10:64453964-64453986 TTCGTGGCTCTCAGCTCTGAAGG + Intergenic
1076282329 10:129258825-129258847 AACCAGGAGCTCAGCTCCGATGG - Intergenic
1078413431 11:11146555-11146577 CGGGTGGATCTCAGCTACCAGGG + Intergenic
1078925094 11:15867582-15867604 AGCCTGGATCTCAGTTGAGATGG + Intergenic
1078930735 11:15910557-15910579 AGTGTGGGTCCCAGCTCCGCAGG - Intergenic
1083180304 11:60980995-60981017 AGCCTGGACCTCAGCTCCTTTGG - Intronic
1093573381 12:20695502-20695524 GACGTGCATCTCAGCTCCCAGGG - Exonic
1099608566 12:84836190-84836212 AGCATGGATCTGAGCTCCTGAGG - Intergenic
1109095248 13:58106246-58106268 TTCGTGGTTCTCAGCTCTGAAGG - Intergenic
1112903479 13:104388574-104388596 TTCGTGGCTCTCAGCTCTGAAGG + Intergenic
1113606394 13:111610657-111610679 AGGGTGGCCCTCAGCTCCCATGG + Intronic
1119025640 14:71150118-71150140 TTCGAGGATCTCAGCTCTGAAGG + Intergenic
1124592376 15:31064626-31064648 ATCGTTGGTCTCAGCTCTGAAGG + Intronic
1144126376 17:12206660-12206682 AGTGTGGTTGTCTGCTCCGAAGG + Intergenic
1145219959 17:21080174-21080196 TTCGTGGCTCTCAGCTCTGAAGG - Intergenic
1146525666 17:33565031-33565053 TTCGGGGATCTCAGCTCTGAAGG + Intronic
1149184784 17:53984718-53984740 TTCGTGGCTCTCAGCTCTGAAGG - Intergenic
1150306584 17:64090667-64090689 AGCGTGGATCTCAGCTCCGATGG - Intronic
1152925829 17:83087378-83087400 GGCGTGGGTCCCAGCTCCGGGGG - Intronic
1153892214 18:9528184-9528206 TGTGTGGCTCTCAGCTCTGAAGG - Intronic
1157377249 18:47177852-47177874 TTCGGGGATCTCAGCTCTGAAGG - Intergenic
1162642449 19:12022381-12022403 TTCGTGGCTCTCAGCTCTGAAGG + Intronic
1165863411 19:38921423-38921445 AGCCTGGCTCTCATCCCCGACGG + Exonic
928937802 2:36698600-36698622 ATAGTGGTTCTCAGCTCCAAAGG + Intronic
931460200 2:62443644-62443666 AGCTTGGATCGCAGCTCCCAAGG - Intergenic
935025290 2:99270789-99270811 TTCGTGGCTCTCAGCTCTGAAGG - Intronic
935915827 2:107948262-107948284 TTCGTGGCTCTCAGCTCTGAAGG - Intergenic
944992098 2:205249515-205249537 TGATTGGATCTGAGCTCCGAAGG - Intronic
946206492 2:218112637-218112659 TTCGAGGATCTCAGCTCTGAAGG + Intergenic
1170946123 20:20892377-20892399 AGAGTCGGTCTCAGCTCCTACGG - Intergenic
1173822727 20:46029530-46029552 AGCCTGGAGCTCAGCTCCATTGG + Intronic
1185060916 22:48606327-48606349 TGAGTGGATCTCAGCCCCCAGGG + Intronic
950494478 3:13325533-13325555 AGGGTGGATTCCAGCTCCCATGG - Intronic
952162358 3:30706553-30706575 TTCGGGGCTCTCAGCTCCGAAGG + Intergenic
954535262 3:51355062-51355084 TGGGTGGATCTCACCTCCCAGGG - Intronic
966511353 3:180766720-180766742 TTCGTGGCTCTCAGCTCTGAAGG + Intronic
968408069 4:359444-359466 AGCGTTGATCACAGCTGAGAGGG + Intronic
969202385 4:5616274-5616296 AACTTGGATCCCAGCTCAGAGGG + Intronic
970095883 4:12462149-12462171 AGCGTGGATATCAGCAGCGGTGG - Intergenic
970815577 4:20152177-20152199 AGTGTAGATCTCAGATCTGAAGG - Intergenic
974636482 4:64569654-64569676 CTCGTGGCTCTCAGCTCTGAAGG + Intergenic
981134098 4:141190442-141190464 AGGGTTGATCTCAGTTCCTAGGG - Intronic
981197797 4:141941219-141941241 TTCGTGGCTCTCAGCTCAGAAGG - Intergenic
984363452 4:178767874-178767896 TTCGGGGATCTCAGCTCTGAAGG + Intergenic
986296877 5:6446708-6446730 AGTGGGAATCTCAGCTGCGACGG - Intergenic
988008263 5:25448542-25448564 TTCGTGGCTCTCAGCTCTGAAGG - Intergenic
992995538 5:82328986-82329008 TTCGTGGCTCTCAGCTCTGAAGG + Intronic
1018594531 6:165464047-165464069 TTCGGGGATCTCAGCTCTGAAGG + Intronic
1019160033 6:170063411-170063433 ACCGTGGAGCTGAGCTTCGAAGG + Intergenic
1029547349 7:101217325-101217347 CGCCTGGATCCCAGCTCCGGAGG + Exonic
1035254400 7:157617058-157617080 AGTCTGGATTTCAGCTCTGACGG + Exonic
1036187331 8:6635319-6635341 AGCGTGGAGCTCAGGTGTGATGG + Intronic
1037670836 8:21013837-21013859 AGCGGGTATCTCAGCTGCCATGG + Intergenic
1037855416 8:22367663-22367685 AGCGTGGGTCGCCGCGCCGAAGG + Intronic
1039434351 8:37549352-37549374 AGCATGGAGCTCAGGTCCAAAGG + Intergenic
1045499399 8:102733447-102733469 AGCATGGTTCTGAGCTCTGATGG + Intergenic
1049462249 8:142735596-142735618 AGCGTGGAGCCCAGCACAGAGGG - Exonic
1049765613 8:144353953-144353975 CGCCTGGCGCTCAGCTCCGATGG - Exonic
1055318351 9:75056439-75056461 TTCGTGGCTCTCAGCTCTGAAGG + Intergenic
1194162194 X:90467865-90467887 CTCGTGGCTCTCAGCTCTGAAGG - Intergenic
1196472228 X:116041309-116041331 TTCGTGGCTCTCAGCTCTGAAGG + Intergenic
1196994433 X:121365991-121366013 TTCGTGGCTCTCAGCTCTGAAGG + Intergenic
1200063502 X:153494237-153494259 AGAGTGGTTCTCATGTCCGAGGG + Intronic
1200508471 Y:4045602-4045624 CTCGTGGCTCTCAGCTCTGAAGG - Intergenic