ID: 1150306585

View in Genome Browser
Species Human (GRCh38)
Location 17:64090680-64090702
Sequence GATCCACGCTACTACGTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 26}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150306583_1150306585 -9 Left 1150306583 17:64090666-64090688 CCCATCGGAGCTGAGATCCACGC 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1150306585 17:64090680-64090702 GATCCACGCTACTACGTGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 26
1150306579_1150306585 23 Left 1150306579 17:64090634-64090656 CCAACACACACCAACCAATGCTG 0: 1
1: 0
2: 0
3: 26
4: 201
Right 1150306585 17:64090680-64090702 GATCCACGCTACTACGTGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 26
1150306578_1150306585 30 Left 1150306578 17:64090627-64090649 CCATATTCCAACACACACCAACC 0: 1
1: 0
2: 0
3: 14
4: 190
Right 1150306585 17:64090680-64090702 GATCCACGCTACTACGTGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 26
1150306584_1150306585 -10 Left 1150306584 17:64090667-64090689 CCATCGGAGCTGAGATCCACGCT 0: 1
1: 0
2: 0
3: 1
4: 69
Right 1150306585 17:64090680-64090702 GATCCACGCTACTACGTGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 26
1150306581_1150306585 9 Left 1150306581 17:64090648-64090670 CCAATGCTGCAAAGACGACCCAT 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1150306585 17:64090680-64090702 GATCCACGCTACTACGTGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 26
1150306580_1150306585 13 Left 1150306580 17:64090644-64090666 CCAACCAATGCTGCAAAGACGAC 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1150306585 17:64090680-64090702 GATCCACGCTACTACGTGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150306585 Original CRISPR GATCCACGCTACTACGTGTG TGG Intronic