ID: 1150306587

View in Genome Browser
Species Human (GRCh38)
Location 17:64090694-64090716
Sequence CGTGTGTGGCAGCTGCTAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 103}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150306581_1150306587 23 Left 1150306581 17:64090648-64090670 CCAATGCTGCAAAGACGACCCAT 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1150306587 17:64090694-64090716 CGTGTGTGGCAGCTGCTAAGAGG 0: 1
1: 0
2: 0
3: 11
4: 103
1150306583_1150306587 5 Left 1150306583 17:64090666-64090688 CCCATCGGAGCTGAGATCCACGC 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1150306587 17:64090694-64090716 CGTGTGTGGCAGCTGCTAAGAGG 0: 1
1: 0
2: 0
3: 11
4: 103
1150306584_1150306587 4 Left 1150306584 17:64090667-64090689 CCATCGGAGCTGAGATCCACGCT 0: 1
1: 0
2: 0
3: 1
4: 69
Right 1150306587 17:64090694-64090716 CGTGTGTGGCAGCTGCTAAGAGG 0: 1
1: 0
2: 0
3: 11
4: 103
1150306580_1150306587 27 Left 1150306580 17:64090644-64090666 CCAACCAATGCTGCAAAGACGAC 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1150306587 17:64090694-64090716 CGTGTGTGGCAGCTGCTAAGAGG 0: 1
1: 0
2: 0
3: 11
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150306587 Original CRISPR CGTGTGTGGCAGCTGCTAAG AGG Intronic