ID: 1150310939

View in Genome Browser
Species Human (GRCh38)
Location 17:64129531-64129553
Sequence GAAAGGGCGTTGGGATCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 151}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150310939_1150310951 10 Left 1150310939 17:64129531-64129553 CCCCTGGATCCCAACGCCCTTTC 0: 1
1: 0
2: 0
3: 11
4: 151
Right 1150310951 17:64129564-64129586 CGGCCCCCGCCAGGCAGCGCCGG 0: 1
1: 0
2: 1
3: 19
4: 266
1150310939_1150310957 25 Left 1150310939 17:64129531-64129553 CCCCTGGATCCCAACGCCCTTTC 0: 1
1: 0
2: 0
3: 11
4: 151
Right 1150310957 17:64129579-64129601 AGCGCCGGCGCCCGCCCGCGAGG 0: 1
1: 2
2: 4
3: 30
4: 180
1150310939_1150310958 28 Left 1150310939 17:64129531-64129553 CCCCTGGATCCCAACGCCCTTTC 0: 1
1: 0
2: 0
3: 11
4: 151
Right 1150310958 17:64129582-64129604 GCCGGCGCCCGCCCGCGAGGAGG 0: 1
1: 0
2: 0
3: 18
4: 275
1150310939_1150310945 -10 Left 1150310939 17:64129531-64129553 CCCCTGGATCCCAACGCCCTTTC 0: 1
1: 0
2: 0
3: 11
4: 151
Right 1150310945 17:64129544-64129566 ACGCCCTTTCGGCTCCTCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 45
1150310939_1150310948 1 Left 1150310939 17:64129531-64129553 CCCCTGGATCCCAACGCCCTTTC 0: 1
1: 0
2: 0
3: 11
4: 151
Right 1150310948 17:64129555-64129577 GCTCCTCCGCGGCCCCCGCCAGG 0: 1
1: 0
2: 6
3: 65
4: 411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150310939 Original CRISPR GAAAGGGCGTTGGGATCCAG GGG (reversed) Intronic
900221560 1:1512022-1512044 GAACAGGCTTTGGGAGCCAGCGG - Intergenic
900601739 1:3505685-3505707 GAAGGGGCGGTGGGCTGCAGGGG - Intronic
903033378 1:20479047-20479069 GAAATGAGGTTGGGATCTAGGGG - Intergenic
904822229 1:33253242-33253264 GAAAGGGGGATGGGTGCCAGTGG + Intergenic
905408580 1:37753498-37753520 GAATGGGCCGTGGGAGCCAGTGG + Intronic
905466610 1:38159074-38159096 CAAATGGCGTTGGGATGCATTGG + Intergenic
905548278 1:38817132-38817154 GCAAGGACTTTGGGATCTAGAGG + Intergenic
905630202 1:39514333-39514355 GAGAGGGCGGGGGGATGCAGAGG + Intronic
905667558 1:39771857-39771879 GAGAGGGCGGGGGGATGCAGAGG - Intronic
905809244 1:40899743-40899765 GAAAGTGCTTTGGAATCCTGGGG - Intergenic
906344050 1:45004275-45004297 GAAAGTGTGTGGGGATCCAGAGG - Exonic
910742171 1:90531627-90531649 GATAGGCCCTTGGGATACAGTGG + Intergenic
912145930 1:106794518-106794540 GAGAGGGCTTTGGAATACAGAGG + Intergenic
916097620 1:161365216-161365238 GAAAGGGAGTTAGAATCCTGAGG - Exonic
916977902 1:170101261-170101283 GAAAGGTAGTGGGGATCCAGGGG + Intergenic
917754415 1:178084807-178084829 TAGAGGGAGTTGGGATGCAGGGG + Intergenic
919624856 1:199901490-199901512 GCAAGGGGGTTGGGATCAAGAGG + Intergenic
922137291 1:222841915-222841937 AAATGGGAGGTGGGATCCAGAGG + Intergenic
924380812 1:243462547-243462569 TACTGGGCGTTGGGATACAGTGG - Intronic
1063251678 10:4281234-4281256 AAAAGGGCTTTGAGATTCAGGGG + Intergenic
1070459525 10:76650346-76650368 GAAAGGGAGTTGAGAGCCACAGG - Intergenic
1075466709 10:122656930-122656952 GAGAGGGCGGTGGGAGCCACAGG + Intergenic
1077587265 11:3463214-3463236 GAGAGGGCGTTGGCAGGCAGGGG + Intergenic
1079103410 11:17555659-17555681 GAAAGGCAGTTGGTATGCAGGGG + Intronic
1080321922 11:31019981-31020003 GAAAGGGAGATGGGATGAAGAGG - Intronic
1084165053 11:67371720-67371742 GAAAGGGTGTTGTTATCAAGAGG + Intronic
1084192947 11:67507076-67507098 GAAAGGGAGTGGGGAGGCAGGGG - Intronic
1084449807 11:69229804-69229826 GAGAGGGGGCTGGGAGCCAGAGG - Intergenic
1090206601 11:124887673-124887695 GATAGGGTGTAGGGATGCAGGGG - Intronic
1092021904 12:5209754-5209776 CAAAGGGTGCTGGGACCCAGAGG - Intergenic
1092413510 12:8271963-8271985 GAGAGGGCGTTGGCAGGCAGGGG + Intergenic
1096006850 12:48180408-48180430 TATAGGGCATTGGGATCCAGAGG + Intronic
1096197456 12:49657825-49657847 GAAAGGGCCATGGGACCCAAAGG + Intronic
1098516454 12:71382287-71382309 GAATGGGCAATGGGTTCCAGGGG - Intronic
1101076957 12:101140291-101140313 GAAAGGTGGGTGGGATCAAGAGG - Intergenic
1103486833 12:121288721-121288743 GAAAGGGGGGTGGGAGTCAGTGG - Intronic
1103792594 12:123482247-123482269 TAAATGGTGTTGGGATCTAGAGG + Intronic
1106235012 13:27854023-27854045 GAAAGGGTGTTGAGTTGCAGCGG - Intergenic
1113247501 13:108414267-108414289 GAAATGGCTTTGGGAGCCTGAGG + Intergenic
1113399553 13:109978436-109978458 CAAAGAGCCTTGGGTTCCAGTGG + Intergenic
1119740127 14:77008705-77008727 GAAAGGGGGTGGGGACCCTGAGG + Intergenic
1120258566 14:82153000-82153022 GAAAGGACATTTGCATCCAGAGG - Intergenic
1123722914 15:23075518-23075540 GAAAGGGTATTGGGACACAGAGG + Intergenic
1126096191 15:45092465-45092487 CAGAGGGGGTTGGGAACCAGAGG + Intergenic
1127953658 15:63834117-63834139 GAAAGGGATTTGGGAGCGAGGGG + Intergenic
1128056882 15:64706385-64706407 GAAATGGCATTGGGATGGAGAGG - Intergenic
1128154242 15:65382899-65382921 GGAAGGGGGCTGTGATCCAGAGG - Exonic
1131511074 15:93049834-93049856 GAAAGGGGAGTGGGTTCCAGTGG + Intronic
1131573151 15:93559608-93559630 GAAAGGGCGATGGTACTCAGAGG + Intergenic
1132984994 16:2761480-2761502 GAAAGGGTGTTGGGATCTTAGGG + Intronic
1134744231 16:16574905-16574927 GAATGGGCTTTGGAATCTAGTGG + Intergenic
1135001253 16:18778853-18778875 GAATGGGCTTTGGAATCTAGTGG - Intergenic
1136933854 16:34440743-34440765 GGGAGGGGGTTGAGATCCAGAGG - Intergenic
1136970718 16:34971071-34971093 GGGAGGGGGTTGAGATCCAGAGG + Intergenic
1137573939 16:49585887-49585909 GAAAAGGAATTGTGATCCAGAGG + Intronic
1138348866 16:56335840-56335862 GATGGGGAGGTGGGATCCAGGGG + Intronic
1140485239 16:75288275-75288297 AACATGGCGCTGGGATCCAGGGG + Intergenic
1147442264 17:40454390-40454412 GAGAGAGTGTTGGGAGCCAGAGG - Intronic
1147718065 17:42521417-42521439 GAAAGGGCTTTGGGATGGCGTGG - Exonic
1149033562 17:52110184-52110206 GAAAGGTTATGGGGATCCAGGGG - Intronic
1150310939 17:64129531-64129553 GAAAGGGCGTTGGGATCCAGGGG - Intronic
1150605503 17:66687134-66687156 GAAAGCCCGTTTGGATCCATAGG - Exonic
1151562060 17:74875710-74875732 GAAATGGCCTTGAGATCTAGGGG - Intergenic
1151954814 17:77374862-77374884 GGGAGGGGGTTGTGATCCAGTGG + Intronic
1152198454 17:78931123-78931145 GAGAGGGTGCTGGCATCCAGTGG - Intergenic
1153160225 18:2196471-2196493 GAAAGAGCCTTGGGATAAAGTGG + Intergenic
1160699376 19:498579-498601 GAGAGCGCGTTGGGGTCCACGGG - Exonic
1160812753 19:1020080-1020102 GGAAGGGAGTGGGGACCCAGCGG + Intronic
1161234171 19:3189829-3189851 GAGCGGGGGCTGGGATCCAGAGG + Intronic
1161399675 19:4061688-4061710 GGAAGGCCGTGGGGACCCAGTGG + Intronic
1161507018 19:4649575-4649597 TCAAGGGCGTTGAGAGCCAGTGG + Intronic
1162379109 19:10321426-10321448 ACAAGGGCGCTGGGACCCAGAGG + Intronic
1163017561 19:14465914-14465936 GAATGGGCGTTGGAATGCAGTGG + Intronic
1164146139 19:22513777-22513799 GAGAGGGCCTGGGGATCTAGTGG - Intronic
1166118898 19:40673301-40673323 GAAACGGCGTTGGAATCAATTGG - Intronic
1167624438 19:50578221-50578243 CAAAGAGGGCTGGGATCCAGTGG - Intergenic
1167710257 19:51106099-51106121 TAAAGTGAGATGGGATCCAGGGG - Intronic
925463946 2:4089547-4089569 GAAAGGGCGTTTGGAAACGGAGG - Intergenic
926113508 2:10196976-10196998 GAAGGGGCTCTGGGGTCCAGGGG + Intronic
926634748 2:15167179-15167201 GCAAGGGCGCTGGGATGCAGAGG - Exonic
928327853 2:30334164-30334186 GAAAGGGCTTGGGGAGGCAGAGG + Intergenic
932580428 2:72989787-72989809 GAAAAGGAGTTGGGTTGCAGAGG + Intronic
933759297 2:85663127-85663149 CAAAGGGCTGTGGGCTCCAGAGG - Intronic
934092802 2:88568256-88568278 GAAAGGGTGTTAGGGTCCCGAGG - Intronic
936554601 2:113483968-113483990 CAAAGGGCTATGGGATTCAGAGG + Intronic
938194408 2:129314261-129314283 GAAGGGGTGTGGGGAGCCAGTGG + Intergenic
940015547 2:149100530-149100552 GACAGGGCAAGGGGATCCAGAGG - Intronic
940167395 2:150790021-150790043 GAAAAGTATTTGGGATCCAGGGG + Intergenic
940221759 2:151360006-151360028 GAAAGGAAGGTGGGATGCAGTGG + Intronic
943794540 2:191975831-191975853 GAAAGGCAGATGGGATCCTGAGG - Intronic
947945478 2:234098130-234098152 GAAAGGGCCTTGGCCTCCTGAGG + Intergenic
948516094 2:238504727-238504749 GCAGGGGCGGTGGGATCCGGAGG + Intergenic
948940453 2:241192937-241192959 TAATGGGCGTAGGGATTCAGTGG + Intronic
1170907345 20:20528131-20528153 GAAAGGTCGGTCGGATACAGGGG + Intronic
1172743011 20:37184055-37184077 GGAAGGGCGAGGGAATCCAGGGG - Intronic
1173749320 20:45464343-45464365 GAAAGGGGTTTGAGATCAAGAGG + Intergenic
1176708868 21:10133696-10133718 GAAGGGTCCTTGGGCTCCAGGGG + Intergenic
1179770193 21:43609630-43609652 GAAAGGTCTTGGGGCTCCAGAGG + Intronic
1183210039 22:36445465-36445487 GAAAGGGTGCTGGGATCGACTGG + Intergenic
1185219073 22:49620080-49620102 GGGAGGGGGTTGGGATCAAGAGG - Intronic
953813315 3:46132831-46132853 GTAGGGGCACTGGGATCCAGAGG - Intergenic
956226534 3:66965278-66965300 GAAAGTGCTATGGGGTCCAGGGG - Intergenic
959647237 3:108717079-108717101 GAACGGGCGTTTGAACCCAGGGG + Intergenic
961891065 3:130130613-130130635 GAGAGGGCGTTGGCAGGCAGGGG + Intergenic
964787916 3:160420091-160420113 GGAAGGGAGTTGTGGTCCAGAGG + Intronic
967805377 3:193710957-193710979 GAAAGGGGGTTGGGGGCCAAGGG - Intergenic
968336173 3:197915603-197915625 GAAAGGCGGTTGGTATCTAGAGG - Intronic
968730123 4:2265572-2265594 GAAAGGAAGTTGGGGCCCAGTGG - Intergenic
969422021 4:7103053-7103075 GCAGGGGCGCTGTGATCCAGGGG + Intergenic
969751556 4:9115481-9115503 GAGAGGGCGTTGGCAGGCAGGGG - Intergenic
969994331 4:11296048-11296070 AAAAGCGGGTTGGGATCAAGGGG - Intergenic
972703189 4:41514298-41514320 CAAAGAGTGTTGGGACCCAGAGG + Intronic
976379240 4:84380309-84380331 GAAAGGGCTTTGGGAGCCACTGG - Intergenic
976912665 4:90326764-90326786 GAAAGGGCCTGGGGAGCAAGAGG - Intronic
980548342 4:134299619-134299641 AAGAGGGGGTTGGGATCAAGAGG - Intergenic
980880096 4:138701120-138701142 GAAAGGGGGTAGGGAGCAAGAGG - Intergenic
995059143 5:107795044-107795066 GAAAAGGCAGTGGGAGCCAGGGG + Intergenic
999382455 5:151131152-151131174 GACAAGTCCTTGGGATCCAGTGG - Intronic
1000229428 5:159301154-159301176 GAATGGGGGTAGGGATGCAGAGG + Intergenic
1001455753 5:171858577-171858599 GAGAGGGTGTTGGGAGCCACGGG - Intergenic
1002061082 5:176626538-176626560 GGAAGGGGTTTGGGAGCCAGGGG + Intronic
1005148569 6:22721479-22721501 CAAAGGGCATTGGTACCCAGAGG - Intergenic
1007262934 6:40576529-40576551 GGAAGGCCGGTGGGACCCAGTGG - Intronic
1007683476 6:43650331-43650353 AGAAGGGAGTTGGAATCCAGGGG + Intronic
1008333122 6:50266352-50266374 GAAAGGTAGTAGGGAGCCAGTGG - Intergenic
1010910720 6:81552134-81552156 CAAAGTGCATTGTGATCCAGAGG + Intronic
1019741782 7:2678685-2678707 CAAAGGGCGTGGTGATTCAGGGG + Intergenic
1021296927 7:18919625-18919647 GAAAGGGAGGTGGGAGGCAGGGG + Intronic
1022094732 7:27131266-27131288 GGAAGGGCGTTGGGACCGAGGGG + Intronic
1026562902 7:71465074-71465096 GAAAAGGGGTTGAGATCAAGAGG + Intronic
1028872760 7:95787196-95787218 GCAAGGGCACTGTGATCCAGTGG - Intronic
1031124278 7:117756010-117756032 GAAAGGGTGCTGAGATCCTGGGG + Intronic
1032118122 7:129134676-129134698 GAAAGTGCATGGTGATCCAGAGG - Intergenic
1034106478 7:148494993-148495015 GCAAGGCTGTTGGCATCCAGTGG - Intergenic
1035860764 8:3025943-3025965 AAAAGGTCTTTGGGGTCCAGTGG + Intronic
1036502831 8:9329174-9329196 GGAAGGGCCATGGGATCCAAGGG + Intergenic
1038136545 8:24792189-24792211 GAAATGGCTTTCAGATCCAGAGG - Intergenic
1038429003 8:27484911-27484933 GACAGGGGGCTGGGATCCAGTGG + Intergenic
1039892949 8:41696898-41696920 GACAGGGCGGTGGGGTCCCGTGG - Intronic
1040435497 8:47387140-47387162 GAAAGGGCTATGGCATCCACAGG + Intronic
1047932932 8:129748840-129748862 GCAAGAGCTTTGGGATCCAGCGG + Intronic
1048336917 8:133509507-133509529 GACAGGGCGTGGGGCACCAGGGG + Intronic
1049401704 8:142430634-142430656 GAAAGGGACTTGGGAACCAGAGG + Intergenic
1049898409 9:133217-133239 CAAAGGGCTATGGGATTCAGAGG - Intronic
1053056856 9:34998047-34998069 GAAAGGGCTTTGGGGTCAGGTGG + Exonic
1053741473 9:41143519-41143541 CAAAGGGCTATGGGATTCAGAGG - Intronic
1054346685 9:63973005-63973027 CAAAGGGCTATGGGATTCAGAGG - Intergenic
1054444462 9:65299662-65299684 CAAAGGGCTATGGGATTCAGAGG - Intergenic
1054485810 9:65721836-65721858 CAAAGGGCTATGGGATTCAGAGG + Intronic
1054686875 9:68287782-68287804 CAAAGGGCTATGGGATTCAGAGG + Intronic
1056951081 9:91041256-91041278 CAAAGGGAGGTGGGATACAGAGG - Intergenic
1060921345 9:127422688-127422710 GAAGAGGCGTTGGGCTCAAGTGG - Intergenic
1062459092 9:136655398-136655420 GACAGGGCGCTAGGATGCAGGGG + Intergenic
1202793629 9_KI270719v1_random:102666-102688 GAAGGGTCCTTGGGCTCCAGGGG + Intergenic
1188025418 X:25203240-25203262 GAAAAGGTGGTGGGACCCAGGGG + Intergenic
1191841084 X:65514001-65514023 GAAAGGGCTATAGAATCCAGGGG - Intronic
1192084082 X:68078200-68078222 GAAGGGGGGTTGGCATCTAGTGG + Intronic
1193410453 X:81156698-81156720 GATAGGCCCTTGGGATACAGTGG - Intronic
1195116374 X:101702842-101702864 GAAAGGTAGTTGGGAACTAGGGG + Intergenic
1199616422 X:149659576-149659598 GAGAGGGCTTTGGGGTCCTGAGG + Intergenic
1199626219 X:149743672-149743694 GAGAGGGCTTTGGGGTCCTGAGG - Intergenic
1201759366 Y:17520389-17520411 GAAAAGCCCTTGGGAGCCAGGGG + Intergenic
1201842188 Y:18385601-18385623 GAAAAGCCCTTGGGAGCCAGGGG - Intergenic