ID: 1150318021

View in Genome Browser
Species Human (GRCh38)
Location 17:64186325-64186347
Sequence GGTCTGCTTCCCACTAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 81}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150318019_1150318021 -4 Left 1150318019 17:64186306-64186328 CCACTCTTGCCTAGAGGGAGGTC 0: 1
1: 0
2: 1
3: 7
4: 102
Right 1150318021 17:64186325-64186347 GGTCTGCTTCCCACTAAAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 81
1150318016_1150318021 -2 Left 1150318016 17:64186304-64186326 CCCCACTCTTGCCTAGAGGGAGG 0: 1
1: 0
2: 0
3: 21
4: 156
Right 1150318021 17:64186325-64186347 GGTCTGCTTCCCACTAAAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 81
1150318018_1150318021 -3 Left 1150318018 17:64186305-64186327 CCCACTCTTGCCTAGAGGGAGGT 0: 1
1: 0
2: 0
3: 9
4: 90
Right 1150318021 17:64186325-64186347 GGTCTGCTTCCCACTAAAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 81
1150318013_1150318021 23 Left 1150318013 17:64186279-64186301 CCATTTGTAGAAAAGTTTTATAT 0: 1
1: 0
2: 1
3: 60
4: 753
Right 1150318021 17:64186325-64186347 GGTCTGCTTCCCACTAAAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150318021 Original CRISPR GGTCTGCTTCCCACTAAAGC TGG Intronic
906009358 1:42509280-42509302 GGTCTGCTCCCCAGGAAAGAGGG - Intronic
906734711 1:48114705-48114727 GTTCTGCTTTCCACTATAACAGG - Intergenic
912413658 1:109494158-109494180 GGTCTGGTTCCCGCTCCAGCTGG + Exonic
919659937 1:200234438-200234460 GTTTGGCTTCCCACAAAAGCTGG - Intergenic
922555288 1:226527908-226527930 GGTCTGCTTCTCACTCCAGGAGG - Intergenic
923053201 1:230403476-230403498 GGGCTTCTTCCCTCTCAAGCTGG + Intronic
1062776737 10:156231-156253 GGGCTGCTTCTCTCTACAGCAGG - Intronic
1063206709 10:3838852-3838874 GATCCTCTTCCCACTAAAGCAGG - Intergenic
1074189560 10:111124033-111124055 ATCCTGCTTCCTACTAAAGCAGG - Intergenic
1079268387 11:18957967-18957989 GGTCTGAGTGCCACTGAAGCAGG + Intergenic
1084024516 11:66439480-66439502 TGTCTCCTCCCCACTACAGCAGG + Intronic
1089630185 11:119779579-119779601 GCTCTGCTTCCCACCAGAACAGG + Intergenic
1090886590 11:130882413-130882435 AGTCTGCATTCCACTCAAGCTGG + Intronic
1092104398 12:5911163-5911185 GGTCTGCTTCCCTTGAAAGCAGG + Intronic
1099512878 12:83559062-83559084 GGTCTGCTACCCACTAGGGAAGG - Intergenic
1100964658 12:99999385-99999407 TGTCTGCTGCCCAGAAAAGCAGG + Intergenic
1102356311 12:112239134-112239156 GGTCTGTTTCTCACTGGAGCTGG + Exonic
1103726073 12:122997942-122997964 TCTCTGCCTCCCGCTAAAGCTGG - Intronic
1119220532 14:72902941-72902963 GGACTGCTTCCCAAAACAGCTGG - Intergenic
1121351858 14:93179829-93179851 TGTCTGCTTCCCACTACTGAGGG + Intergenic
1123398457 15:19960519-19960541 GGTTTGCTTTCTACTACAGCAGG + Intergenic
1123855582 15:24407575-24407597 GGTCTGCTTCCTACTGAAAGGGG + Intergenic
1123860486 15:24461145-24461167 GGTCTGCTTCCTACTGAAAGGGG + Intergenic
1123864115 15:24499767-24499789 GGTCTGCTTCCTACTGAAAGGGG + Intergenic
1125021325 15:34989559-34989581 AGTCTGCTTCCAACAGAAGCAGG + Intergenic
1128474861 15:67988674-67988696 TGTGAGCTTCCCACTACAGCTGG - Intergenic
1129850209 15:78789497-78789519 AGGCTGCTTCCCTGTAAAGCAGG - Intronic
1133570396 16:7034659-7034681 GTTCTGCTCCCCAATAAAGAGGG - Intronic
1138410250 16:56833701-56833723 GGTCTGATTCCCATTAGGGCTGG + Intronic
1138898348 16:61237880-61237902 GCTCTGCTTCTCACTAACGGTGG - Intergenic
1138919175 16:61505832-61505854 GGTGTGCCTCCCACTCAGGCTGG + Intergenic
1139701674 16:68711582-68711604 GTTCTGCTTCCCACTGGAGAGGG + Intronic
1140892226 16:79294989-79295011 AGTCTACTTCCCCCTAGAGCAGG + Intergenic
1141297204 16:82781289-82781311 GGTCTGCATTTCCCTAAAGCTGG - Intronic
1143451608 17:7040062-7040084 GATCTGCCTCCCCCTAGAGCAGG + Exonic
1144863005 17:18317540-18317562 GCTCTCCTTCCCAATACAGCAGG - Exonic
1148355413 17:46972351-46972373 GGACTTCTTCCCACTATAGCTGG - Intronic
1149917948 17:60629047-60629069 GGTCATCTTCCCACTAAAGAAGG - Intronic
1150318021 17:64186325-64186347 GGTCTGCTTCCCACTAAAGCTGG + Intronic
1153237533 18:3002868-3002890 GGTCTGCTTCTGCGTAAAGCAGG - Intronic
1157965374 18:52202867-52202889 GGTCTGCTTCTTATTAAAGATGG + Intergenic
1160238923 18:77108644-77108666 GGACTGCTTCCTAGTAAATCTGG - Intronic
926070494 2:9884740-9884762 GGGTTGCTTCTCTCTAAAGCTGG + Intronic
931144837 2:59506228-59506250 GGCCTGCTTTCCTATAAAGCAGG + Intergenic
932567461 2:72918555-72918577 GGTCTCCCTCCCAGGAAAGCAGG + Intronic
937336632 2:121066247-121066269 TGTCTGAGCCCCACTAAAGCTGG - Intergenic
937771284 2:125723340-125723362 GGTCTTCTTCCCTCAAAACCAGG + Intergenic
939706205 2:145456935-145456957 GGTCTTATTCCCAATAAAACTGG - Intergenic
939999838 2:148956109-148956131 GGTCTTCTCCCCACTCAAGGAGG + Intronic
940343414 2:152604496-152604518 GGTCTGCTTCTCAGGAGAGCTGG + Intronic
942098167 2:172553457-172553479 GGTCTGGTCCCCAGGAAAGCTGG + Intergenic
942606996 2:177702627-177702649 GGGCTGCCTCCCACTGAAGTTGG - Intronic
948600472 2:239105115-239105137 GGTCAGCCTCCCAAGAAAGCAGG - Intronic
948657384 2:239485109-239485131 GGGCTGCCTCCCCCTAACGCAGG - Intergenic
1169513044 20:6285681-6285703 GGTCTGCTTATCCCTAAACCAGG + Intergenic
1170446591 20:16434293-16434315 GGTCTTCTTCCCACGAGATCTGG - Intronic
1170584478 20:17724051-17724073 GGTCTGCATCCCAGCAAAACCGG - Intronic
1170684857 20:18560281-18560303 GCTCTGCTTACCACAGAAGCTGG - Intronic
1172977447 20:38917732-38917754 GGTCTGCTTGCAAGTAAAGTTGG - Intronic
1175086759 20:56465981-56466003 CATCTGCTTCCCAGTAGAGCCGG + Intergenic
1176268075 20:64220953-64220975 AGTCTGCCTCCCACTGAGGCCGG - Intronic
1176745146 21:10645262-10645284 GGTTTGCTTTCCACTACAGCAGG + Intergenic
1185313471 22:50169408-50169430 GGTCCCCTTCCCACTATACCAGG - Intergenic
958451723 3:94281313-94281335 GGTCTGCCTCCCAGTATGGCAGG - Intergenic
962265697 3:133942886-133942908 GGTCTGGTTCCCAGGGAAGCTGG + Intronic
968673774 4:1866046-1866068 CCTCTGCTTCCCACTAGAGAAGG - Intergenic
985509695 5:306094-306116 GGTCTGTTTCTAATTAAAGCAGG + Intronic
985833389 5:2252170-2252192 CATCTGCCTCCCACTAAAGCAGG - Intergenic
996282199 5:121743563-121743585 GTTCTGCTTCCCACTGAAGGAGG + Intergenic
999777081 5:154820165-154820187 GGTCGGCTTCCCGGAAAAGCAGG - Exonic
1006897955 6:37482758-37482780 TGTCTCCTTCCCACTCGAGCTGG + Intronic
1007948217 6:45844851-45844873 GGTCAGCTTCCCCCAAAATCAGG - Intergenic
1015274875 6:131373849-131373871 GTTCTGCTTCACAATAGAGCAGG - Intergenic
1016019332 6:139219314-139219336 GGCCTGCTTGTCACTAAATCTGG - Intergenic
1019769416 7:2874269-2874291 GGTCTTCCTCCCACAGAAGCAGG - Intergenic
1024612348 7:51078368-51078390 GGTCAGCTTCCCCCTAAGGCTGG - Intronic
1024726226 7:52199370-52199392 GGTCTGCCTGCCACCAAACCCGG - Intergenic
1025086629 7:56028705-56028727 GCTCTGCTGCCCAATCAAGCAGG - Intronic
1027912718 7:84273064-84273086 TGTCAGGTTCCTACTAAAGCAGG + Intronic
1034040445 7:147871598-147871620 GGGCTGCTGCCCACTGAAGTGGG + Intronic
1036623328 8:10443760-10443782 GGTGAGCTTCCAAATAAAGCTGG + Intergenic
1045242765 8:100416884-100416906 GCTCTGCCACCCACTCAAGCAGG - Intergenic
1047496982 8:125415507-125415529 GGTCAGCTCCCCACTCAGGCAGG - Intergenic
1048889514 8:138935092-138935114 GGGCTGCATCCCAGGAAAGCCGG - Intergenic
1055759399 9:79590594-79590616 GCTCTGCTTACAACTAAAGCAGG - Intronic
1059890556 9:118797204-118797226 GGCCTTCTTTCCACTAAAGAAGG - Intergenic
1062338286 9:136082120-136082142 GGTCAGCTCATCACTAAAGCAGG + Intronic
1195534975 X:106000694-106000716 GGTATGCTTCTCATTCAAGCAGG - Intergenic
1196409292 X:115399146-115399168 AGTCTGGTTGCCACTGAAGCAGG + Intergenic
1199988397 X:152969040-152969062 GGCCTGCTACCCTCTAGAGCAGG - Intronic
1201340073 Y:12924481-12924503 GGTCTGCGTCCCACATATGCAGG - Intergenic