ID: 1150322705

View in Genome Browser
Species Human (GRCh38)
Location 17:64229859-64229881
Sequence CCTCACATTGAGAAGCTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 202}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150322705 Original CRISPR CCTCACATTGAGAAGCTGAA TGG (reversed) Intronic
901194478 1:7432801-7432823 CCTCTCCTGGTGAAGCTGAAAGG - Intronic
902865014 1:19272276-19272298 GTTCACATTGAGAAGCAGAGGGG - Intergenic
905445088 1:38022514-38022536 CATCACATTCTGGAGCTGAAAGG - Intronic
908304585 1:62799163-62799185 CCACACTTTGGGAGGCTGAAGGG - Intronic
913470913 1:119184821-119184843 CAGCACTTTGAGAAGCTGAGGGG - Intergenic
914763004 1:150614225-150614247 CATCACTTTGGGAGGCTGAAGGG - Intronic
915835818 1:159173558-159173580 CCACTCACTGAGGAGCTGAAGGG + Intronic
915866167 1:159501328-159501350 CCTCACATTGAGAATTTCTAGGG - Intergenic
918282130 1:183017432-183017454 CAGCACTTTGGGAAGCTGAAGGG + Intergenic
918426145 1:184412020-184412042 CATCACATTGAAAAGCTGTCCGG - Intronic
920428565 1:205899018-205899040 CCACACTTTGGGAGGCTGAAGGG - Intergenic
922442606 1:225668651-225668673 CCTCCCCTTGATTAGCTGAAGGG + Intergenic
924098469 1:240579046-240579068 CCTGACAATGAGAGTCTGAAGGG - Intronic
1063278774 10:4601769-4601791 CCTCACAATTGGAAGGTGAAAGG + Intergenic
1063770320 10:9190025-9190047 CTGCACTTTGAGAGGCTGAATGG - Intergenic
1067717937 10:48704106-48704128 CAGCATAGTGAGAAGCTGAAGGG - Intronic
1070306213 10:75240665-75240687 CCTCATCTGGAGAGGCTGAATGG + Intergenic
1070547369 10:77463263-77463285 CCCCACAGTGGGAAGGTGAAGGG + Intronic
1071485836 10:86102211-86102233 CCTCAGAATGACAAGCTGCATGG + Intronic
1074828090 10:117229003-117229025 CATCACTTTGGGAAGCTGAGGGG - Intergenic
1076051021 10:127333257-127333279 TCTCACATTGTGAAGCTGTGGGG - Intronic
1079873189 11:25825825-25825847 CCGGACATTGAGAGGCTCAAAGG + Intergenic
1081402325 11:42657632-42657654 TCTCACCTTCTGAAGCTGAAAGG - Intergenic
1081957268 11:47104355-47104377 GCTAACAAAGAGAAGCTGAAGGG - Intronic
1082010353 11:47446286-47446308 CAGCACTTTGAGAAGCTGAGGGG - Intronic
1082890520 11:58134053-58134075 TCTCTCATTTAGAAGCTGATTGG + Intronic
1083374784 11:62210750-62210772 CTTCACATTGAGAATCTTTAGGG + Intronic
1083987250 11:66223512-66223534 CCTCACATGGAACTGCTGAATGG + Intronic
1084257583 11:67953698-67953720 CAGCACTTTGAGAGGCTGAAAGG - Intergenic
1086912046 11:92484070-92484092 GCTCACATTGGAAAACTGAAGGG - Intronic
1087673884 11:101136639-101136661 CCGCACTTTGGGAAGCTGAGTGG - Intergenic
1088076689 11:105857723-105857745 CTTCTCATTGAAAAGCAGAATGG + Intronic
1088454269 11:110017115-110017137 CAGCACTTTGGGAAGCTGAAGGG + Intergenic
1095843701 12:46722653-46722675 CCTCACATTCAAAAGCTGAGAGG - Intergenic
1097236852 12:57546490-57546512 CCTCACCTTGAGAAGCAGGCAGG + Intronic
1099323524 12:81181285-81181307 TCTCACCTGGAGAAGCTGTATGG + Intronic
1100644691 12:96516398-96516420 ACTCAAATGGAGAAGCTGCAGGG + Intronic
1101083644 12:101213786-101213808 CCTCACAATCAGAAGGAGAACGG - Intergenic
1101498382 12:105277839-105277861 CCTCACACTGAGAAGTTCCATGG - Intronic
1107819143 13:44270625-44270647 CCTCACATTGAGAATACAAAAGG + Intergenic
1109458563 13:62625610-62625632 CTTCACATTGTGCAGCTTAAGGG - Intergenic
1109536461 13:63728285-63728307 CCTCTCATTGAGATGCTGTGAGG - Intergenic
1113405635 13:110036847-110036869 CTTCCCATTGAGAAGCAGCATGG - Intergenic
1113924758 13:113935250-113935272 CCTCTCCCTGAGGAGCTGAAGGG - Intergenic
1116999836 14:51361253-51361275 CCTCACAATGAGACTCTGATAGG - Intergenic
1117073239 14:52075055-52075077 CCTCACAGTGAGAAGATGGCTGG - Intergenic
1118879242 14:69811941-69811963 ACTGAAATTGAGAAGGTGAACGG + Intergenic
1119414945 14:74463652-74463674 CCTCAGATGGAGAAGCCTAAGGG + Intergenic
1121976915 14:98413313-98413335 CCTCACCTTGATAAACTGTAAGG - Intergenic
1125774665 15:42201421-42201443 CAACACTTTGGGAAGCTGAAGGG - Intronic
1125975430 15:43947017-43947039 CCTCAAATTGACAAGGTGTACGG - Intronic
1126674840 15:51151958-51151980 CCTCATATTGGGAATATGAAAGG - Intergenic
1126905364 15:53359147-53359169 CTGCCCATTGAGAGGCTGAATGG - Intergenic
1127565659 15:60185619-60185641 CAGCACTTTGGGAAGCTGAAGGG + Intergenic
1129103747 15:73290576-73290598 CCTCACTTTGATAAGCATAAAGG + Intronic
1129147742 15:73664191-73664213 CAGCACTTTGGGAAGCTGAACGG - Intergenic
1129705990 15:77794929-77794951 CCTCACACTGGGAAGCTGGTGGG - Intronic
1130160776 15:81397858-81397880 GGTTACATTGAAAAGCTGAATGG - Intergenic
1131516503 15:93081154-93081176 CTGCAGATTGAGAAGCTGAGGGG - Intronic
1132312937 15:100870363-100870385 CCCCTCCTTGAGCAGCTGAAGGG + Intergenic
1133873492 16:9711375-9711397 CAGCACTTTGAGAGGCTGAAGGG - Intergenic
1135056007 16:19232580-19232602 CAGCACTTTGAGAGGCTGAAGGG + Intronic
1136712266 16:32248780-32248802 TCTCTCATTCAGAACCTGAAGGG + Intergenic
1136755649 16:32680624-32680646 TCTCTCATTCAGAACCTGAAGGG - Intergenic
1136812464 16:33189748-33189770 TCTCTCATTCAGAACCTGAAGGG + Intergenic
1136818940 16:33299828-33299850 TCTCTCATTCAGAACCTGAAGGG + Intronic
1136825503 16:33356361-33356383 TCTCTCATTCAGAACCTGAAGGG + Intergenic
1136830569 16:33455132-33455154 TCTCTCATTCAGAACCTGAAGGG + Intergenic
1138352973 16:56356274-56356296 CTTCACATTTAGAATTTGAAAGG + Intronic
1139565469 16:67772865-67772887 CCTCAACTTGAGAATCTGAGTGG - Intronic
1140417444 16:74786108-74786130 CCTCACAATCAGAAGGTAAAAGG + Intergenic
1140690301 16:77477398-77477420 CCTCACATGGTGAAGGTGGAGGG + Intergenic
1141816931 16:86417264-86417286 CCTCACAGTAGGAAGCTGACTGG + Intergenic
1202991041 16_KI270728v1_random:12718-12740 TCTCTCATTCAGAACCTGAAGGG + Intergenic
1203057791 16_KI270728v1_random:940980-941002 TCTCTCATTCAGAACCTGAAGGG - Intergenic
1143060283 17:4194882-4194904 CCCCAAATTTAGAAACTGAACGG - Intronic
1146065000 17:29627645-29627667 CCAAACATTTAGAATCTGAAAGG + Exonic
1146637355 17:34516447-34516469 CCCCACATTGAGAAACAGACTGG + Intergenic
1146685500 17:34838832-34838854 CCACACATGGAGAAGAAGAAAGG - Intergenic
1150168695 17:62968494-62968516 CCTTACCTTGAGAAGCTGTTGGG + Intergenic
1150322705 17:64229859-64229881 CCTCACATTGAGAAGCTGAATGG - Intronic
1152041998 17:77909618-77909640 TCTCGAACTGAGAAGCTGAAAGG - Intergenic
1153843718 18:9030127-9030149 CCTCACATGGCAAAACTGAAAGG - Intergenic
1153914875 18:9736220-9736242 CATCACTTTGAGAAGCTGAGGGG - Intronic
1156369586 18:36460886-36460908 CCTCACTTTCAGCAGGTGAAGGG - Intronic
1159371777 18:67536795-67536817 CCTCAAATTTAGAAGAGGAAAGG + Intergenic
1163414483 19:17177789-17177811 TCTAGCATTGAGCAGCTGAAAGG - Intronic
1164332887 19:24277583-24277605 CCTCAGCTTAAGAAGCTGATGGG - Intergenic
1164940015 19:32244837-32244859 CCTCAGTTTGAGAAACTCAAGGG - Intergenic
924969054 2:107547-107569 CAGCACTTTGAGAAGCTGAGGGG - Intergenic
925745489 2:7039867-7039889 CCTGACACTGTGAAGCTCAATGG - Exonic
926962378 2:18372419-18372441 CCTCACTTTGAGAACCTGGTGGG - Intergenic
927607140 2:24495678-24495700 CCCCACAATTATAAGCTGAAAGG - Intronic
927701712 2:25273345-25273367 CAGCACTTTGGGAAGCTGAAAGG - Intronic
928209643 2:29314068-29314090 CGTCACACTGAGAGGCTGGAGGG + Intronic
928905993 2:36368224-36368246 CCTCACGTTGGGAGGATGAAAGG + Intronic
931068659 2:58618910-58618932 ACTCACTTTGAAAAGCTGATGGG + Intergenic
931365873 2:61618285-61618307 CAGCACTTTGGGAAGCTGAAGGG + Intergenic
932401975 2:71486872-71486894 CTTCTCAGAGAGAAGCTGAAGGG + Intronic
933107327 2:78347460-78347482 CATCACTTTGGGAAGCTGAGGGG - Intergenic
934903827 2:98181903-98181925 CCACACCTTGAGAAGCAGAGAGG + Intronic
935398725 2:102638078-102638100 GCTCATATTGAGAAACTGAGAGG - Intronic
936675860 2:114713234-114713256 CAGCACTTTGGGAAGCTGAAGGG - Intronic
937482854 2:122280843-122280865 CTGCACAATGAGAAGCAGAATGG - Intergenic
937550097 2:123077430-123077452 CAGCTCCTTGAGAAGCTGAATGG - Intergenic
937799811 2:126070444-126070466 CTTCACATTGAGAAGGAGGAAGG - Intergenic
939122205 2:138130972-138130994 CCGCTCATTGGGAAGCAGAATGG + Intergenic
939851484 2:147311293-147311315 CCACACAGTGAGAAGGTGAGAGG + Intergenic
939888217 2:147704859-147704881 CCTCACAATGAAACTCTGAATGG - Intergenic
941927037 2:170906141-170906163 CCCCAGACAGAGAAGCTGAAGGG + Intergenic
942281638 2:174370296-174370318 CCTCACTTTGGGAGGCTGAGAGG - Intronic
947290465 2:228568449-228568471 CCTCACTTTGGGAAGCGCAAGGG + Intergenic
948134675 2:235627887-235627909 CCTCCCATTGAGAAGATTATAGG - Intronic
948137982 2:235651388-235651410 CCTCATTTTGACAAGCTTAAGGG + Intronic
948533757 2:238631299-238631321 CCACACTTTGGGAGGCTGAAGGG - Intergenic
1171489828 20:25508956-25508978 CCTCACATGGGCAGGCTGAAAGG - Intronic
1172179475 20:32992446-32992468 TCTCACTCTGAGAAGCTGAGTGG + Intronic
1172724704 20:37029490-37029512 ACTCAAATTGAAAACCTGAAAGG + Intronic
1174439484 20:50538731-50538753 CCAAACACTGAGAAGATGAAGGG - Intronic
1176994477 21:15539238-15539260 CATCACATGGAGAAGCTCTAAGG - Intergenic
1179793644 21:43769855-43769877 CAGCACTTTGAGAGGCTGAAGGG + Intergenic
1182182650 22:28366632-28366654 CAAGACATAGAGAAGCTGAATGG + Intronic
1182236937 22:28883579-28883601 CCTCACGTGGAGCAGATGAAAGG + Exonic
1183282028 22:36937238-36937260 TCTCACAGAGAGAACCTGAACGG - Intronic
949373457 3:3361109-3361131 TCTCAAATTTAGAAGCTAAAAGG - Intergenic
952271211 3:31833458-31833480 CCTGACATGCAGAAGCTGCATGG + Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
955146970 3:56329404-56329426 CCTCACTGTGAGAACCTGATAGG - Intronic
958124393 3:89336810-89336832 CAGCACTTTGGGAAGCTGAAGGG + Intronic
959346516 3:105201674-105201696 TTTCACATTCAGAAACTGAAAGG - Intergenic
962246492 3:133799561-133799583 CTTCATTTTGAGAAGTTGAATGG - Intronic
963604712 3:147404671-147404693 CCCCACCTTGAGAAGAGGAACGG + Intronic
965574364 3:170203297-170203319 CAGCACTTTGAGAGGCTGAAGGG + Intergenic
966089551 3:176116332-176116354 CAGCACTTTGAGAAGCTGAGGGG - Intergenic
966951771 3:184826103-184826125 CCTCACAATTATAAGCAGAAAGG + Intronic
972131115 4:35834420-35834442 GCTGACCTTGAGAAACTGAATGG - Intergenic
972145576 4:36020517-36020539 ATTCACGTTGAGAAGCAGAATGG + Intronic
972872920 4:43322927-43322949 CCTCACATTTAGATGCAGACTGG + Intergenic
973240985 4:47955429-47955451 CAGCACTTTGAGAGGCTGAAGGG - Intronic
975639398 4:76484321-76484343 CCGCACTTTGAGAGGCTGAGGGG + Intronic
975728728 4:77317471-77317493 CCTTACAGTGACAAGCTGAAGGG - Intronic
976252170 4:83063946-83063968 CATCACTTTGAGAGGCTGAGGGG - Intronic
976745928 4:88402907-88402929 ACTCAGATCAAGAAGCTGAAGGG + Intronic
979975317 4:127189065-127189087 CCTCACATCCAGTAGCTGACTGG - Intergenic
980476138 4:133319384-133319406 CATCACTTTGGGAGGCTGAAGGG - Intergenic
982670783 4:158318147-158318169 CAGCACTTTGGGAAGCTGAAGGG + Intronic
982799011 4:159679689-159679711 CTTCTCATTGAGAATCTGATAGG - Intergenic
983497906 4:168464524-168464546 CAACACTTTGAGAGGCTGAATGG - Intronic
985022170 4:185703173-185703195 TCTAAAATTGAGAAGCTCAAGGG - Intronic
986370122 5:7071761-7071783 CAGCACTTTGAGAGGCTGAACGG - Intergenic
989143810 5:38228460-38228482 CCTCACTGTGAGAACATGAAGGG + Intergenic
989844089 5:46117472-46117494 CAGCACATTGGGAGGCTGAAGGG - Intergenic
994546917 5:101178347-101178369 CCTGACATGGAGTAGCTGGAGGG + Intergenic
997172591 5:131738760-131738782 CCACACTTTGGGAGGCTGAAAGG - Intronic
999673254 5:153975593-153975615 CCAGGCATTGAGGAGCTGAAAGG + Intergenic
1000493402 5:161945577-161945599 ACTCACAGTGAGAACCTGATGGG + Intergenic
1001948801 5:175801553-175801575 CCTGCCATTGAGAAGCTGTGTGG + Intronic
1002187232 5:177460026-177460048 CAGCACACTGAGAAGCGGAACGG + Intronic
1004137053 6:12977748-12977770 CCTCACTTTTAAAAGCTAAATGG - Intronic
1004302664 6:14472688-14472710 TCTCACATAGAAAAGCTAAAAGG + Intergenic
1005839095 6:29728862-29728884 CCTCACAATGCGTCGCTGAAGGG - Intronic
1010501125 6:76601548-76601570 CAGCACTTTGGGAAGCTGAATGG + Intergenic
1011888982 6:92132997-92133019 CCTCCCATTGAGAAACTTTAGGG + Intergenic
1012013097 6:93817271-93817293 GATCACTTTGAGAAGATGAATGG - Intergenic
1024423403 7:49197163-49197185 AAGCACATTGAGAAGCTAAATGG - Intergenic
1025056821 7:55771946-55771968 CCTGACATTGTCCAGCTGAATGG + Intergenic
1026999122 7:74639527-74639549 CATTACATTTAGAAGCTGACAGG - Intergenic
1029221586 7:98994812-98994834 CCTGTCTTTCAGAAGCTGAAAGG + Exonic
1031573373 7:123386291-123386313 TCATACATTGAGAAGCTGTAGGG - Intergenic
1031674818 7:124596719-124596741 GGGCACATTGAGAAGATGAATGG - Intergenic
1032066875 7:128778411-128778433 TTTCACCTTGAGAAGCTGAAAGG + Intergenic
1033937939 7:146611337-146611359 CAGCACTTTGGGAAGCTGAAGGG - Intronic
1035872649 8:3152819-3152841 CCGCACATTCAGCAGCTGCATGG - Intronic
1036022648 8:4863031-4863053 CCTCACATTGTCAAGCCCAAGGG - Intronic
1036886449 8:12558341-12558363 CATCACATTGACAAGATGAAAGG + Intergenic
1038421606 8:27437419-27437441 CCGCACATCGTGAAGCTGATCGG + Exonic
1038527158 8:28285450-28285472 CATCACACTGAAAAGCTGGAGGG + Intergenic
1038757410 8:30354315-30354337 CAGCACTTTGAGAGGCTGAAGGG - Intergenic
1039894161 8:41704584-41704606 GCTGACATTGACAAGCTGAATGG + Intronic
1042098731 8:65248914-65248936 CCTCTGATTGGGAAACTGAAAGG - Intergenic
1046982780 8:120354514-120354536 CATCACATTGCGAACATGAAAGG - Intronic
1048392601 8:133981863-133981885 CTTCATGCTGAGAAGCTGAATGG + Intergenic
1048935560 8:139352906-139352928 CAACACTTTGGGAAGCTGAAGGG + Intergenic
1049121853 8:140746815-140746837 CCTCATATTGTGAAGCTGATTGG - Exonic
1050698340 9:8305166-8305188 CCTCACATTAACAAAATGAAAGG - Intergenic
1050729486 9:8691742-8691764 CATCACATTGAAAATGTGAAAGG - Intronic
1052572792 9:30249725-30249747 CCTGACATTCAGAAGCTAACTGG - Intergenic
1056804934 9:89721207-89721229 CCTCACATTTAGAGGCCTAAGGG + Intergenic
1187261020 X:17685387-17685409 CCTCACAATGACAACCTGCAGGG - Intronic
1187299553 X:18034442-18034464 CATAACATTTTGAAGCTGAAAGG - Intergenic
1187973589 X:24683089-24683111 CCTCACAGTGAGAATCTGGTGGG - Intergenic
1188236236 X:27734545-27734567 CCTCTCATTTACACGCTGAAAGG - Intronic
1188822277 X:34789987-34790009 ACTCTCAGTCAGAAGCTGAAGGG + Intergenic
1188923311 X:36007147-36007169 CCTCACATTCAAAAACTGCAGGG - Intergenic
1189518985 X:41745777-41745799 CTTCACATTGAAAATCTGCAGGG + Intronic
1190950301 X:55137074-55137096 CCTCAAATAGAGAAGAGGAACGG + Intronic
1192416960 X:70989529-70989551 CAGCACTTTGAGAGGCTGAAGGG - Intergenic
1193954803 X:87846061-87846083 CATCACATTCTGAAGCTGATAGG - Intergenic
1194569908 X:95543566-95543588 CAACACTTTGAGAGGCTGAATGG + Intergenic
1195860809 X:109380817-109380839 CCCCTCATTTAAAAGCTGAAGGG - Intronic
1196939783 X:120763685-120763707 CCTCACCTTGAGAACCTGGTGGG - Intergenic
1197121081 X:122893641-122893663 CATCACAGTAATAAGCTGAAAGG - Intergenic
1197951212 X:131899279-131899301 CTTTTCATTGAGTAGCTGAAAGG + Intergenic
1198522304 X:137465339-137465361 ACTGACATTGAAAAGCAGAATGG + Intergenic
1199686783 X:150272187-150272209 CCAGACATGGAGAAGCAGAATGG + Intergenic
1201183540 Y:11374157-11374179 CCGCACTTTGGGAAGCTGAGGGG + Intergenic
1202194079 Y:22278000-22278022 CCTAACATAGAGCACCTGAAGGG - Intergenic
1202231445 Y:22663259-22663281 GCTTCCATGGAGAAGCTGAAAGG - Intergenic
1202311713 Y:23532906-23532928 GCTTCCATGGAGAAGCTGAAAGG + Intergenic
1202559089 Y:26137688-26137710 GCTTCCATGGAGAAGCTGAAAGG - Intergenic