ID: 1150324582

View in Genome Browser
Species Human (GRCh38)
Location 17:64246543-64246565
Sequence ATATTTAAGACAATGCTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 277}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150324582_1150324586 0 Left 1150324582 17:64246543-64246565 CCTACCAGCATTGTCTTAAATAT 0: 1
1: 0
2: 3
3: 17
4: 277
Right 1150324586 17:64246566-64246588 TGGGCTGCCCCCTAGAAGAATGG 0: 1
1: 0
2: 1
3: 12
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150324582 Original CRISPR ATATTTAAGACAATGCTGGT AGG (reversed) Intronic
901047730 1:6408097-6408119 ATAGCTAAAACAATGCTTGTGGG - Intergenic
902763363 1:18598877-18598899 TTACTTAAGAGAATGCTGGCGGG - Intergenic
903219294 1:21860031-21860053 ATATTGAAGACAATGCTGAAAGG - Intronic
903492105 1:23737063-23737085 ATCTGTACAACAATGCTGGTAGG + Intergenic
903985598 1:27225702-27225724 ATGTTTAAGCCACTGCTAGTTGG + Intergenic
905849708 1:41264619-41264641 AGATCTAAGAGAATGCTGGCAGG - Intergenic
907610820 1:55868994-55869016 ATATTAAAGACAATGCCACTAGG - Intergenic
908568320 1:65381858-65381880 ATGTTTAAGACAAAGCTGGTAGG + Intronic
908990254 1:70078484-70078506 ATATTTAATAAACAGCTGGTTGG - Intronic
909031984 1:70552995-70553017 AAGTTTAAGACAAAGGTGGTTGG - Intergenic
909461630 1:75922207-75922229 ATTGTTAAGACAATGTTGATAGG + Exonic
909486156 1:76176565-76176587 ATCTATAAGCTAATGCTGGTGGG - Intronic
910161544 1:84277654-84277676 ATACTTAACACACTGCTGGCAGG + Intergenic
910532547 1:88256176-88256198 ATATTTAAGAAAATAATGGCTGG - Intergenic
910752289 1:90645386-90645408 ATATTTATTACAACGCTGTTAGG + Intergenic
912066154 1:105746224-105746246 ATATTTAAGAGAGTATTGGTAGG + Intergenic
912325221 1:108751433-108751455 ATATTTAAGTTAATGCTTTTGGG - Intronic
915043902 1:152994868-152994890 ATCTTTCAGACATTGCTTGTGGG + Intergenic
916831310 1:168494269-168494291 ATATCTAAGACAATGCTTTCAGG + Intergenic
918676500 1:187292370-187292392 GTATTAAAGACAATTCTGGCGGG - Intergenic
918694300 1:187524219-187524241 ATATTTAAGCCAATACTTGTTGG - Intergenic
918977147 1:191504176-191504198 GTATTTAGGACAATGGTGGGAGG - Intergenic
919606967 1:199694920-199694942 ATATTTCAGACAATTCTAGATGG - Intergenic
920042981 1:203116043-203116065 TCTTTTAAGACAGTGCTGGTGGG + Intronic
921022423 1:211248418-211248440 TTGTTTAAGACACTGCTGTTTGG + Intergenic
921470323 1:215540228-215540250 ATATATAGGACATTCCTGGTTGG + Intergenic
924742656 1:246804962-246804984 ATATCTAATACATTGCTGCTGGG + Intergenic
1063298957 10:4834510-4834532 ATAATTACAACAATGCTGGCTGG - Intronic
1064365652 10:14705419-14705441 CTATTGTAGACAATGCTGCTAGG - Intronic
1064715943 10:18176772-18176794 ATGTTTCAGAGAATGCTGGGTGG + Intronic
1064881811 10:20064096-20064118 AGATTCAAGAAAATGGTGGTGGG - Intronic
1065042136 10:21707921-21707943 ATATTTAAGACAAGGCTTAAAGG - Intronic
1065078377 10:22103406-22103428 ACACTTAAGACAAGGCTAGTAGG + Intergenic
1065169881 10:23016279-23016301 AATTTTAGGACAAGGCTGGTGGG - Intronic
1065769027 10:29059536-29059558 ATCTTTAAGACAGAGCTGGAAGG - Intergenic
1065878785 10:30021486-30021508 ACATTTAAAATAATGATGGTTGG - Intronic
1067976509 10:51031980-51032002 ATATTTATCTCAAAGCTGGTTGG + Intronic
1069257916 10:66357905-66357927 AAATTGGACACAATGCTGGTGGG - Intronic
1069847984 10:71385839-71385861 ATATATAACACGATGCTGGTGGG - Intergenic
1070351331 10:75594607-75594629 ATATTAAGTACAGTGCTGGTTGG - Intronic
1070725768 10:78788162-78788184 ATATTTAGGTAAATGATGGTCGG - Intergenic
1072903924 10:99433253-99433275 ATAATCAAGCCAATGCTGATAGG + Intergenic
1073985760 10:109207106-109207128 ATAACTATGGCAATGCTGGTTGG - Intergenic
1074296515 10:112194292-112194314 ACATTTATGACACTTCTGGTTGG + Intronic
1074960128 10:118437142-118437164 ATATTTAAGACACAGATGGAAGG - Intergenic
1075199002 10:120386351-120386373 AAGTTTAAGTCAATGCTGGATGG + Intergenic
1075996459 10:126880396-126880418 ATATTTAAGAAATTGATGGGGGG - Intergenic
1078943391 11:16034518-16034540 AGATTTAAGACAATGCTGAGAGG + Intronic
1081663388 11:44902351-44902373 ATGCTTAGGACCATGCTGGTTGG + Intronic
1087617329 11:100502910-100502932 AGGTTTCAGACAATTCTGGTGGG - Intergenic
1087846641 11:102980981-102981003 ATATAAAAGATAATGCAGGTTGG + Intergenic
1088496664 11:110438240-110438262 ACACTTAAGACAGTCCTGGTGGG - Intronic
1090143333 11:124290228-124290250 ATGTTTTATACACTGCTGGTGGG - Intergenic
1092152559 12:6260966-6260988 ATTTTTAAGACAAAGCTAGTGGG + Intergenic
1093141361 12:15513978-15514000 ATATTTAAGACAGTATTGCTTGG - Intronic
1093292154 12:17340380-17340402 CAATTTAATACAATGCTGGAGGG - Intergenic
1095521121 12:43067295-43067317 ATATAAAAGACAATGGTGGCTGG + Intergenic
1096660644 12:53122100-53122122 TTATTTAAGAGCATGCTGGCTGG - Intronic
1098447620 12:70583090-70583112 AAATTTCATACATTGCTGGTGGG + Intronic
1098854071 12:75632290-75632312 ATAATTAAGATAATGCTTATAGG - Intergenic
1099205876 12:79725805-79725827 ATTTATAAGAATATGCTGGTTGG - Intergenic
1099213778 12:79828413-79828435 ATATTAAAGACTATGATGGCTGG - Exonic
1099405601 12:82258137-82258159 ATATTTGAGGCTATGCTAGTAGG + Intronic
1099908110 12:88795998-88796020 AAATTCAAGTCAATGCTGCTTGG - Intergenic
1100028397 12:90156331-90156353 ATATTTAAGACACTGCATTTTGG + Intergenic
1103109615 12:118264114-118264136 ATCTTTCATACACTGCTGGTGGG + Intronic
1104166461 12:126235054-126235076 ACATTTCAGTCAATGATGGTTGG + Intergenic
1104539179 12:129646341-129646363 CTGTCTAAGGCAATGCTGGTAGG + Intronic
1106014525 13:25855773-25855795 ATCTTTCATACACTGCTGGTGGG - Intronic
1106309319 13:28539760-28539782 ATAATTAAGACACTGCTGGTAGG + Intergenic
1106598067 13:31163429-31163451 ATATGTAAGAAAAAGTTGGTGGG - Intergenic
1107015259 13:35703278-35703300 TTATTTAAGCCATTTCTGGTGGG - Intergenic
1107098406 13:36561207-36561229 ATATTGAAGACAGGGGTGGTGGG - Intergenic
1107107218 13:36657790-36657812 ATATTTGTGACCATGCTGTTAGG - Intergenic
1107652888 13:42562353-42562375 ATATTTAAGATGAGGCTTGTGGG - Intergenic
1108608163 13:52061030-52061052 AAATTTTAGAAAATGATGGTTGG + Intronic
1109347824 13:61137639-61137661 ATATTTTACACAGTGCTGGTAGG - Intergenic
1109400317 13:61819176-61819198 ATGTTTTATACACTGCTGGTAGG + Intergenic
1110904932 13:80875094-80875116 ATGTTTAAGACAATTATGATTGG + Intergenic
1111154247 13:84301100-84301122 ATATTTCAGACAACGTTAGTTGG - Intergenic
1111646887 13:91042340-91042362 TTATTTAAGTTAAAGCTGGTTGG - Intergenic
1111686980 13:91514257-91514279 ATCTTTTACACATTGCTGGTGGG - Intronic
1111701861 13:91700057-91700079 ATATTTCAGCCTCTGCTGGTAGG + Intronic
1112120932 13:96410717-96410739 TTATTTAAAATAATGCTAGTAGG - Intronic
1113659083 13:112092351-112092373 ATATTGAAGTTAATGGTGGTAGG + Intergenic
1114426261 14:22626051-22626073 ATTTTTTATACAATGTTGGTGGG + Intergenic
1115904335 14:38190071-38190093 GTATTTATGTTAATGCTGGTTGG - Intergenic
1116088461 14:40272852-40272874 ATATTTAAGACAATCATTGTTGG + Intergenic
1117805999 14:59491283-59491305 ATAGAGAAGACGATGCTGGTGGG + Intronic
1118105271 14:62651760-62651782 AAATTTAAGAAAATTTTGGTTGG + Intergenic
1118655900 14:67948418-67948440 ATATTTATAACAGTGCTGCTGGG - Intronic
1119835252 14:77743734-77743756 CTAGTTAAGACAATGGGGGTAGG + Intronic
1121253876 14:92517698-92517720 ATGTTTCAGACACTCCTGGTGGG - Intronic
1123674398 15:22694744-22694766 AGAAATAAGACAATGCTGGAGGG + Intergenic
1124041368 15:26108438-26108460 AAATATAAGAGAATGTTGGTAGG + Intergenic
1124326409 15:28767732-28767754 AGAAATAAGACAATGCTGGAGGG + Intergenic
1127417684 15:58772698-58772720 ATACTTAAGAGAATGGTGATGGG + Intronic
1129554804 15:76496320-76496342 AAATATAAGACAATGCTCTTGGG + Intronic
1131248387 15:90815395-90815417 ATATTTAAATAAATGCTGGGGGG + Exonic
1131294771 15:91137302-91137324 ATTTTTAAAACAATGGAGGTGGG - Intronic
1131419911 15:92296615-92296637 ATTTTTAAGACAGTGATGGCCGG + Intergenic
1133664684 16:7954939-7954961 ATATTTAAAAATATGCTGGCTGG - Intergenic
1134243851 16:12525236-12525258 TAATTTAAGTCAATACTGGTAGG - Intronic
1134421469 16:14094954-14094976 ATATTTAAAATAATTCTGATAGG - Intronic
1134891987 16:17848973-17848995 AGATGAGAGACAATGCTGGTTGG - Intergenic
1135065092 16:19302945-19302967 AGATTTAAGGCAATGTTTGTGGG - Intronic
1135361952 16:21822582-21822604 ATGTTTAACAAACTGCTGGTGGG - Intergenic
1137435431 16:48450979-48451001 ACATTTCAGACACTGCTGTTTGG + Intergenic
1139316775 16:66078833-66078855 ATACTTTACACACTGCTGGTGGG - Intergenic
1140503508 16:75454949-75454971 ATATTATGGACAATGCTGTTGGG - Intronic
1142564710 17:832495-832517 ATTTTTAAGGAAATGGTGGTGGG + Intronic
1146448944 17:32956508-32956530 ATGTTTAAGCCACTGTTGGTTGG + Intergenic
1149744221 17:59079358-59079380 ATCTCTAAGAAAATGCTGGCAGG + Intronic
1150277546 17:63909621-63909643 TTTATTAAGACAAGGCTGGTGGG + Intronic
1150324582 17:64246543-64246565 ATATTTAAGACAATGCTGGTAGG - Intronic
1150850386 17:68698654-68698676 ATATTTAAAAAAATGTTCGTTGG + Intergenic
1152182405 17:78831644-78831666 ATATATAAAACGCTGCTGGTTGG + Intronic
1153169555 18:2300276-2300298 AGATTCAAGACAATACTAGTTGG + Intergenic
1154474104 18:14736176-14736198 ATATTTTTGACAATGCTAATAGG - Intronic
1155593331 18:27453406-27453428 TTATTTACCAAAATGCTGGTGGG + Intergenic
1155693957 18:28661335-28661357 CTATTTAATACAATGGTGTTGGG + Intergenic
1155968996 18:32063452-32063474 ATAATTCATACATTGCTGGTGGG + Intronic
1156299435 18:35823146-35823168 ATAGCTAGGACAATGTTGGTTGG - Intergenic
1157003304 18:43552365-43552387 ATATTTTAGTCAATCATGGTGGG - Intergenic
1157926618 18:51773671-51773693 ATAATTTAGAAAATGCTGTTTGG - Intergenic
1160270471 18:77378947-77378969 CTATTTAAAAAAATGCTGTTGGG + Intergenic
1160669819 19:355878-355900 AGATCTCAGACAAAGCTGGTAGG - Intergenic
1162116711 19:8434384-8434406 ATATTTTAAAATATGCTGGTAGG - Intronic
1163865737 19:19771916-19771938 ATATATTAGAAAAGGCTGGTCGG + Intergenic
1165716652 19:38050157-38050179 GCATTTAAGACAGTGCTGGCTGG + Intronic
1166698987 19:44871160-44871182 AGATTTAAAAAAAAGCTGGTCGG - Intronic
1167032906 19:46975318-46975340 AAATTTAAGACCTTGCTAGTGGG + Intronic
1168366311 19:55790958-55790980 ATACTTAAGACAATTCTTGAAGG + Intronic
925069970 2:958887-958909 ATATCTAAAACAATGATGCTTGG + Intronic
925682642 2:6439182-6439204 ATAGTGAAGACAAGGCTGGGTGG - Intergenic
927530537 2:23794304-23794326 ACATTTAAAACAGTGCTGGCTGG - Intronic
929375272 2:41279186-41279208 ATCTTTCATACATTGCTGGTTGG - Intergenic
931361509 2:61581579-61581601 ATATGTTATACACTGCTGGTGGG - Intergenic
931851881 2:66259750-66259772 ATTTTTCAGACATTGCTGGTAGG + Intergenic
936880520 2:117244807-117244829 ATATTTAACAAAATGCAGCTGGG + Intergenic
939447625 2:142330646-142330668 CTATTTAACACATTGCTGGGAGG + Intergenic
939868221 2:147498802-147498824 ATATTTAAGCCCTTGCAGGTGGG + Intergenic
940398208 2:153218146-153218168 TTATCTAAGACAAAGCTGATAGG - Intergenic
940677124 2:156737849-156737871 ACATTTTAGAAAATGCTGGTGGG + Intergenic
940865538 2:158814066-158814088 ATATTTGAGAGATTGCAGGTAGG - Intronic
941516696 2:166488932-166488954 TTATTTAAGAGACTGTTGGTCGG - Intronic
942777247 2:179597074-179597096 ACATTAAAGACTCTGCTGGTAGG - Intronic
944209117 2:197188070-197188092 ATGTTTAAGACAGTACTTGTTGG - Intronic
944623680 2:201546656-201546678 ATCTTTCATACATTGCTGGTTGG + Intronic
945001828 2:205359698-205359720 ATATTAAAAACAATGCTGAGTGG - Intronic
945829733 2:214769241-214769263 ATGTTAAAGACCATGCTGGATGG - Exonic
946942979 2:224789577-224789599 ATTATAAAGACAATGCTTGTAGG + Intronic
947586287 2:231358893-231358915 ATATTGAAGATAGTCCTGGTTGG - Intronic
1168989299 20:2080466-2080488 ATATTTAAGATAAGTCTGGAAGG + Intergenic
1169722603 20:8695399-8695421 CTATTTAAAAAAATGATGGTAGG + Intronic
1172241383 20:33414907-33414929 TTATTTAAGTCATTGCTTGTTGG + Intronic
1172345966 20:34199427-34199449 AAATCTCAGACATTGCTGGTGGG - Intronic
1174624716 20:51904529-51904551 ATATTCAAGGTAATGCTGATTGG + Intergenic
1175731482 20:61357283-61357305 ATGTCTCAGACAATGCTGGGAGG - Intronic
1178142914 21:29704160-29704182 ATATCTAAGACTATGCTAGGAGG + Intronic
1178940889 21:36904549-36904571 ATATTTAAGAGAATTATGGGTGG - Intronic
1179176099 21:39009405-39009427 AGATTTCAGACAATGCTTGTTGG - Intergenic
1181897818 22:26126322-26126344 AAATTTAGGACAATGCTGAAGGG - Intergenic
1182641479 22:31771432-31771454 ATTTTTAAAAAATTGCTGGTTGG + Intronic
1183082283 22:35464163-35464185 AGATTTCAGACACTGCAGGTAGG - Intergenic
1184032192 22:41901656-41901678 ATCTTTAAAAAAAAGCTGGTGGG + Intronic
1185201738 22:49510851-49510873 AACTTTCAGACATTGCTGGTAGG - Intronic
949125172 3:438478-438500 ATATTTAGGACAATGCCCTTGGG - Intergenic
951403934 3:22270421-22270443 ATAATTGAGAAAATGTTGGTTGG - Intronic
951741226 3:25926186-25926208 ATCTTTATGACAATACTGGGTGG - Intergenic
952247289 3:31607893-31607915 ATATTAAATAAAATGCTGCTGGG - Intronic
952458598 3:33499935-33499957 ATATTTAAAACATTCTTGGTAGG - Intronic
952910956 3:38185645-38185667 ATATTTAAGAACCTGCTGCTAGG + Intronic
953574095 3:44098955-44098977 ATATTAAAGACAAAGTTTGTTGG + Intergenic
955039907 3:55306085-55306107 ATATTCAAGAAAGTGCTGATGGG - Intergenic
956719672 3:72106756-72106778 AAATTCAAGACAAAGCTGGGAGG - Intergenic
957448755 3:80348532-80348554 ATAGTTAAGAAATTGATGGTTGG + Intergenic
959451492 3:106508377-106508399 ACACTTAACACACTGCTGGTGGG + Intergenic
959604965 3:108232590-108232612 TTATTTAAGACAGAGTTGGTTGG - Intergenic
960222168 3:115126236-115126258 ATATTTTATACAATGCTGGTGGG + Intronic
960755926 3:121012424-121012446 AGATCTAACACATTGCTGGTGGG - Intronic
961695580 3:128701823-128701845 ATATATAAGACAAAGGAGGTGGG + Intergenic
963336413 3:143978948-143978970 ATCTTTAAAACAATCCTGTTAGG - Intronic
964396642 3:156252820-156252842 GTTTTTAAGACAATGCGCGTTGG - Intronic
967487094 3:190045682-190045704 GTATTTTAGATAATCCTGGTGGG + Intronic
969821109 4:9720995-9721017 ATATTTAAGAGAACCCTGGCTGG + Intergenic
970992333 4:22227139-22227161 ATTTTAAAGACAATGAAGGTCGG + Intergenic
971782698 4:31056874-31056896 CTATTTAAGAAAATGTTGGCTGG - Intronic
971991514 4:33902947-33902969 ATAATTAATACAATGCTTCTTGG + Intergenic
972752290 4:42002864-42002886 ATACTTAATACACTGCTGGTGGG - Intronic
974395919 4:61334796-61334818 ATATGTGAGACAACTCTGGTGGG + Intronic
974777241 4:66500867-66500889 GTGTTTAAGAAAATGCTGGCCGG + Intergenic
974990761 4:69085739-69085761 ATTTTTAATTCAATCCTGGTTGG + Intronic
975160320 4:71117275-71117297 ATATTTAAAACATTTTTGGTGGG - Intergenic
977893333 4:102337515-102337537 ATAGGTAAGACAGTGCTGCTAGG - Intronic
978290933 4:107139165-107139187 ATATTTAAAACAATGCTACTTGG + Intronic
979124629 4:116952774-116952796 ATCTTTGAGACAATTCTGATTGG - Intergenic
980924063 4:139116644-139116666 AGAAGGAAGACAATGCTGGTAGG - Intronic
980984052 4:139678350-139678372 AACTTTCATACAATGCTGGTGGG - Intronic
982031263 4:151303315-151303337 CTATTCAAGAAAATGGTGGTTGG - Intronic
982626481 4:157773469-157773491 ATATTTTATACAATGCTGTATGG + Intergenic
987477116 5:18404197-18404219 ACACTTGAGACACTGCTGGTGGG - Intergenic
987882013 5:23760266-23760288 AGTTTTAAGATAATTCTGGTGGG + Intergenic
992539318 5:77746839-77746861 ATGTTGAAGAAAATGTTGGTTGG - Intronic
993595287 5:89847239-89847261 AAATTTAAGAAAATTATGGTGGG + Intergenic
993993673 5:94692065-94692087 CTAATTTAGACAATGCTGGCTGG + Exonic
995741791 5:115363654-115363676 ACATTTAAAGCAGTGCTGGTGGG - Intergenic
998552017 5:143086918-143086940 ATATTTGAGACAGTGGAGGTAGG - Intronic
998715069 5:144873960-144873982 CTATTTAAGCCAATGCTTGAGGG + Intergenic
999081599 5:148849356-148849378 TAAGTTAAGACAATGCTGCTAGG - Intergenic
999659737 5:153847984-153848006 ATACTTAACACACTGTTGGTGGG - Intergenic
1000992503 5:167925485-167925507 ATGCTTAAGACACTGCTGGTGGG + Intronic
1002907383 6:1461238-1461260 ATATTTAAAAATATGCTGGCTGG - Intergenic
1002965020 6:1956330-1956352 ATTTTCAAAACTATGCTGGTAGG + Intronic
1004065448 6:12239535-12239557 ATATTTAAGTTATTGCAGGTAGG - Intergenic
1005354019 6:24964747-24964769 ATATTTCATACATTGCTGGTGGG - Intronic
1005678520 6:28181387-28181409 AAGTTTAACAAAATGCTGGTGGG + Intergenic
1006323933 6:33338789-33338811 ATATTTAAGACAGAGCGGGCTGG - Intergenic
1006518696 6:34558971-34558993 CCATCTAAGGCAATGCTGGTGGG + Intergenic
1007168117 6:39842746-39842768 TTATTTAGGAGAATGCAGGTAGG + Intronic
1008137761 6:47796492-47796514 ATATTTAATACAAAGCTTGATGG - Intronic
1009422631 6:63480671-63480693 ACACTTAACACATTGCTGGTGGG + Intergenic
1009906226 6:69872897-69872919 AAATTTAAGAGAATGCATGTAGG + Intronic
1009927431 6:70136492-70136514 ATATTAAAAACAATGCTGAGTGG + Intronic
1010393522 6:75363836-75363858 ATACTAAAGAAAAAGCTGGTTGG + Intronic
1013143060 6:107359306-107359328 ATCTTTAAGAGAATACTGGCTGG - Intronic
1013651281 6:112197322-112197344 ATTGTTAAGACAAGGCAGGTGGG + Intronic
1013990092 6:116243708-116243730 ATATGTATTACAATGGTGGTTGG + Intronic
1016581973 6:145638140-145638162 ATATTCAAGAAAATGCTGAGTGG - Intronic
1016693672 6:146967382-146967404 ATTTTGAAGACAAAGCCGGTAGG - Intergenic
1020219069 7:6220627-6220649 ATCTTTCATACATTGCTGGTGGG + Intronic
1020567317 7:9814228-9814250 ATAGTTAAGACAATGAAGGAAGG - Intergenic
1021424588 7:20485898-20485920 ATATTAAAGATAAAGATGGTCGG + Intergenic
1021654136 7:22858133-22858155 ATATTTAAGAATATACTGCTGGG - Intergenic
1022063552 7:26826245-26826267 ATATCTAAGAAGCTGCTGGTGGG + Intronic
1022997081 7:35768057-35768079 TAATTTAAGACAATTCTGCTGGG + Intergenic
1023274658 7:38505206-38505228 ATAATTAAGACTATGCTTGACGG + Intronic
1025075714 7:55941157-55941179 TAATTAAAGACAATGCTGGCTGG + Exonic
1026639768 7:72114078-72114100 ATTTGAAAGACAATGCTGGAGGG + Intronic
1028181916 7:87734171-87734193 ATCTTTCATACATTGCTGGTGGG + Intronic
1028464604 7:91136157-91136179 AGATAAAAGACAAGGCTGGTCGG - Intronic
1028568960 7:92265282-92265304 ATATTTGAGACAAAGATGGAAGG + Intronic
1030423299 7:109337624-109337646 AGATTTAGGAGAATACTGGTGGG + Intergenic
1030460585 7:109829686-109829708 ATAATTAAGTAAATGATGGTGGG + Intergenic
1030992856 7:116321777-116321799 ATATTTAAGGCTATGTTGATAGG - Intronic
1031049114 7:116927338-116927360 ATATTTAAGCCACTGCTCTTTGG + Intergenic
1031609697 7:123810395-123810417 ATATTTAAGAAACTCCTTGTTGG + Intergenic
1032616803 7:133481706-133481728 ATATTAAATAAAATGTTGGTAGG - Intronic
1033118524 7:138647077-138647099 ATATTTAAGAGGATGATGGCCGG + Intronic
1034649778 7:152680842-152680864 ATTTTTAAAATAATACTGGTTGG - Intergenic
1034934331 7:155188907-155188929 GTATTTATGTCAAGGCTGGTGGG - Intergenic
1035915284 8:3613799-3613821 ATAGTTATGACATTGCTTGTTGG - Intronic
1036761436 8:11511833-11511855 ATATTTAGGATAACACTGGTTGG + Intronic
1038097002 8:24324473-24324495 ACATTCAAGAAAATGCTGCTGGG + Intronic
1038271540 8:26079771-26079793 ATACTGAAGACAATGATGATGGG - Intergenic
1039082083 8:33743524-33743546 ATATTGAAGATATTTCTGGTAGG - Intergenic
1041049548 8:53919831-53919853 AAATATAAGACAATGCTGTTAGG - Intronic
1041083180 8:54232897-54232919 ATGTCTCAGACATTGCTGGTGGG + Intergenic
1043075295 8:75691211-75691233 ACACTTAATACACTGCTGGTGGG - Intergenic
1043356177 8:79415218-79415240 ATATTTTATACATTGCTGATGGG + Intergenic
1044049328 8:87480666-87480688 ATTATAAAGACAATGCTGTTGGG - Intronic
1046483857 8:114859232-114859254 ATATTGAAGACAGTGCTGACTGG - Intergenic
1046927441 8:119806766-119806788 ATATTTAAGAAAATGCTCAGAGG - Intronic
1046991545 8:120462216-120462238 AAATTTTAGATCATGCTGGTAGG + Intronic
1047411923 8:124630947-124630969 GTATTTAGGAACATGCTGGTAGG - Intronic
1049115729 8:140685767-140685789 ACACTTAAGACACTGCTGGTGGG + Intronic
1050470198 9:5980297-5980319 ATCTTCAAGAAAATGCTGATAGG - Intronic
1050615896 9:7401403-7401425 AGATTAAAGACACTCCTGGTGGG - Intergenic
1050810626 9:9742065-9742087 ATATTAAAAACACTGTTGGTGGG - Intronic
1051430895 9:16979235-16979257 ATATATAAGACATTCCTGGTAGG + Intergenic
1052625102 9:30964299-30964321 ATCTTTCATACATTGCTGGTGGG + Intergenic
1055053528 9:72002734-72002756 ATATTTCATACATTTCTGGTGGG + Intergenic
1055545329 9:77365257-77365279 ATATAGAAGATAATGCTTGTTGG + Intronic
1056766904 9:89449787-89449809 TTATTTACCAAAATGCTGGTGGG - Intronic
1056841730 9:90003425-90003447 ATATTTAAGTCAAAGCGGGGGGG + Intergenic
1058926962 9:109675676-109675698 ATAATTAAAACAATGATGATAGG - Intronic
1060319827 9:122547901-122547923 ATACTTAACGCAATGTTGGTAGG - Intergenic
1185990635 X:4891178-4891200 GTGTTTAAGTGAATGCTGGTTGG + Intergenic
1185991601 X:4897577-4897599 GTGTTTAAGTGAATGCTGGTTGG + Intergenic
1186236558 X:7517251-7517273 ATTTTTAAGTAAATGTTGGTGGG - Intergenic
1186623023 X:11261398-11261420 ATATTCTAGACTGTGCTGGTAGG - Intronic
1188610477 X:32089899-32089921 ACACTTAACACACTGCTGGTGGG - Intronic
1189979786 X:46497665-46497687 ATATTAAAGACAAAGCTGAGTGG + Intergenic
1189990678 X:46591299-46591321 ATCTTTCAGACATTGTTGGTGGG - Intronic
1194463447 X:94201499-94201521 ATATCTGGGACAGTGCTGGTTGG + Intergenic
1194470330 X:94286013-94286035 ATGTTTATAACACTGCTGGTAGG - Intergenic
1195135535 X:101903942-101903964 ATATTTAATACAAGGGTGGATGG + Intronic
1196978489 X:121185867-121185889 ATATTTTTGACCATGCTAGTTGG - Intergenic
1197027407 X:121770513-121770535 ATACTTAACACACTGTTGGTGGG - Intergenic
1197789025 X:130232100-130232122 ATATTTAAGTGAAGCCTGGTTGG + Intronic
1197857398 X:130930676-130930698 ATCTTTCATACATTGCTGGTGGG + Intergenic
1198226320 X:134648970-134648992 ATATTAAAGACAAAGCAGGCCGG + Intronic
1200087437 X:153614597-153614619 ATATTTAAGATAGTGCGGGCTGG - Intergenic
1201469857 Y:14321020-14321042 ATCTTTTATACACTGCTGGTGGG - Intergenic
1202171427 Y:22048846-22048868 ATTTTTAAGAAAGTGCTTGTTGG + Intergenic
1202219935 Y:22537526-22537548 ATTTTTAAGAAAGTGCTTGTTGG - Intergenic
1202323181 Y:23658140-23658162 ATTTTTAAGAAAGTGCTTGTTGG + Intergenic
1202547591 Y:26011914-26011936 ATTTTTAAGAAAGTGCTTGTTGG - Intergenic