ID: 1150326417

View in Genome Browser
Species Human (GRCh38)
Location 17:64262279-64262301
Sequence CTCTGGAGAAAGAGCGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 5, 3: 27, 4: 367}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150326412_1150326417 21 Left 1150326412 17:64262235-64262257 CCCTGGACAGTGTCTGTAAAACA 0: 1
1: 0
2: 3
3: 29
4: 269
Right 1150326417 17:64262279-64262301 CTCTGGAGAAAGAGCGAGGGTGG 0: 1
1: 0
2: 5
3: 27
4: 367
1150326411_1150326417 24 Left 1150326411 17:64262232-64262254 CCTCCCTGGACAGTGTCTGTAAA 0: 1
1: 0
2: 0
3: 11
4: 151
Right 1150326417 17:64262279-64262301 CTCTGGAGAAAGAGCGAGGGTGG 0: 1
1: 0
2: 5
3: 27
4: 367
1150326413_1150326417 20 Left 1150326413 17:64262236-64262258 CCTGGACAGTGTCTGTAAAACAC 0: 1
1: 0
2: 0
3: 14
4: 157
Right 1150326417 17:64262279-64262301 CTCTGGAGAAAGAGCGAGGGTGG 0: 1
1: 0
2: 5
3: 27
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150326417 Original CRISPR CTCTGGAGAAAGAGCGAGGG TGG Intronic
900072924 1:788359-788381 CTCTGAAGAAAGAGAGAGAGAGG + Intergenic
900754504 1:4424388-4424410 CACTGGAGAAAAAGAGAGGGAGG - Intergenic
900777963 1:4598926-4598948 CTCTGGAGCCAGAGAGACGGAGG + Intergenic
901059422 1:6465294-6465316 CTGGAGAGAAAGAGGGAGGGAGG - Intronic
901813076 1:11778806-11778828 CTCTGGAGAAGGTGAGAGGTAGG + Exonic
902389928 1:16097417-16097439 CTCTGGAGCTTGAGGGAGGGAGG + Intergenic
902652975 1:17848700-17848722 CTCTGGAGAAGGAAGCAGGGGGG - Intergenic
902777675 1:18685004-18685026 CTCTGGCAAAAGAGGGAGGAGGG + Intronic
902810567 1:18885677-18885699 CCCTGGGGAGTGAGCGAGGGAGG + Intronic
904679213 1:32217057-32217079 GTCTGGAGAAAGACAGAGGCTGG - Intronic
904703986 1:32376740-32376762 CTCTGTAGAGAGAGAAAGGGAGG + Exonic
905018418 1:34792894-34792916 CGCTGGAGAGAGGGCGGGGGCGG - Intronic
905289379 1:36911113-36911135 CACTGGGGAGAGAGGGAGGGAGG + Intronic
905427180 1:37895498-37895520 CTGTGGGGAGAGAGAGAGGGAGG - Intronic
905838961 1:41157059-41157081 CTCTGGAGACTGAGCGGGGAGGG - Intronic
907110415 1:51921865-51921887 ATAGGGAGAAAGAGGGAGGGGGG - Intronic
911150113 1:94590342-94590364 CCCTGGGGAGAGAGGGAGGGCGG - Intergenic
911248598 1:95548732-95548754 CTCTGGAGAAAGTGTGAATGGGG - Intergenic
912248936 1:107991017-107991039 CTCTGGGGAAACAGCCAGTGAGG - Intergenic
913334926 1:117700652-117700674 GTGTGGAGGAAGAGCAAGGGAGG + Intergenic
914248420 1:145902421-145902443 CTCTGGAGAAATGGACAGGGCGG - Intronic
914703609 1:150154219-150154241 CTCTGGAGAAGGAGGGGGAGAGG + Intronic
915010214 1:152678516-152678538 GTCTGAAGAAAGAGAAAGGGTGG + Intergenic
916347884 1:163814727-163814749 ACTTGGGGAAAGAGCGAGGGAGG - Intergenic
916490777 1:165300471-165300493 CTCTGTAGTAAAAGCAAGGGAGG - Intronic
917081644 1:171261878-171261900 CACTGGGGAAGGAGAGAGGGTGG + Intronic
917461043 1:175229418-175229440 CTCAGGAGGAAGAGGGAGAGAGG + Intergenic
918114198 1:181483075-181483097 GGTTGGAGAAAGAGGGAGGGAGG - Intronic
918309808 1:183277621-183277643 CTCTGGACAGAGATCGAGGCAGG - Intronic
919861169 1:201740228-201740250 CTCTGGCGGAAAAGCGAGCGCGG - Intronic
920194982 1:204220972-204220994 CTTGGGAGAAAGAGAGAGAGAGG + Exonic
920292833 1:204936041-204936063 CTCTGGGGAGAGTGGGAGGGGGG + Intronic
920447403 1:206029121-206029143 CTTTGGAGAGAGAGAGAGAGGGG + Intergenic
920866896 1:209760429-209760451 CTCTGGACAAGGAGGGTGGGTGG + Intronic
922059439 1:222073723-222073745 CTCTGGTGGAAGTGGGAGGGAGG + Intergenic
922504816 1:226120438-226120460 CTCTGGACACAGAGGGATGGAGG - Intergenic
922603427 1:226873942-226873964 CTCTGGGGCAAAAGGGAGGGTGG - Intronic
923559170 1:235025423-235025445 CTCTGGAGGAACAGTGAGGATGG + Intergenic
924636395 1:245791603-245791625 GACGGGAGAAAGAGAGAGGGGGG + Intronic
924940682 1:248811022-248811044 CTGTGCAGCAAGAGTGAGGGTGG + Exonic
1064984398 10:21195657-21195679 CTAAGGAGAGAGAGGGAGGGAGG - Intergenic
1065374879 10:25028690-25028712 CTCTGGAGAAAAAGACAGGCAGG - Intronic
1066654603 10:37686503-37686525 CTGGGGAGATAGAGTGAGGGAGG + Intergenic
1067462241 10:46466325-46466347 TCCTGGAGAAAGAGAAAGGGAGG - Intergenic
1067624956 10:47918312-47918334 TCCTGGAGAAAGAGAAAGGGAGG + Intergenic
1067830564 10:49609346-49609368 CTCTGGAAAATGAGGGATGGGGG + Intronic
1068436609 10:57000584-57000606 TTCTGGAGATAGAGCTGGGGAGG + Intergenic
1074642374 10:115401363-115401385 CTGTGGAGAAAGAGCCAGTAAGG + Intronic
1075290337 10:121224494-121224516 CTTTGGAGCAAGAGCCAGGAGGG - Intergenic
1075753980 10:124796300-124796322 ATCTGGAGGGAGAGCGAGGTTGG - Intergenic
1076218581 10:128715529-128715551 GTCTGGAGACAGAGGCAGGGTGG - Intergenic
1076286838 10:129307728-129307750 CTCTGGTGAGAGAGAGAAGGTGG + Intergenic
1076701827 10:132277259-132277281 CGCTGGAGAGAGAGCCAGGGAGG + Intronic
1077614806 11:3667119-3667141 CACTGCAGAAAGTGAGAGGGGGG - Intronic
1078448556 11:11423627-11423649 CTCTGGAGAGAGAGAGATGTTGG - Intronic
1079706732 11:23630853-23630875 CTCGGGAGAAAGGGTGAGGAAGG - Intergenic
1080283860 11:30586275-30586297 ATCTGGGGAGAGAGCGAGCGAGG + Intronic
1080393638 11:31870977-31870999 CTCTGGGGAGAGGGCCAGGGGGG - Intronic
1081334892 11:41852895-41852917 CCCTGGAGAAAGAGAGAAGGTGG + Intergenic
1081655188 11:44852610-44852632 CACTGGAGAGAGAGCCAAGGGGG - Intronic
1082610043 11:55284512-55284534 CTTTGGTGAAAGAGAGAGAGAGG + Intergenic
1082959558 11:58905727-58905749 ATCTGGACAAATAGGGAGGGTGG + Intronic
1084176026 11:67422831-67422853 CACTGAAGAGAGAGGGAGGGTGG - Intronic
1084471563 11:69362546-69362568 TTCTGGAGAAAGAAAGAAGGAGG + Intronic
1084547701 11:69822570-69822592 CCCTGGAGAGAGAGCTGGGGTGG + Intergenic
1085192930 11:74644594-74644616 CTCTGGCTAAAGAGCCTGGGTGG - Intronic
1085390656 11:76180493-76180515 TTCTGGAGAGAGAGAGAGGGTGG + Intergenic
1085915578 11:80883799-80883821 CTCTGGGGAATGATTGAGGGAGG - Intergenic
1087165716 11:95000221-95000243 AGCAGGAGAAAGAGAGAGGGGGG + Intergenic
1090185902 11:124739022-124739044 CTCAGGAGCAAGGGCGAGGATGG + Intergenic
1090369511 11:126238542-126238564 CTCTGGGGAAAGAGAGTTGGGGG + Intronic
1090859595 11:130640964-130640986 AGTTGGAGAAAGAGAGAGGGAGG - Intergenic
1090894101 11:130954137-130954159 GTCTTGAGAAAGAAGGAGGGAGG + Intergenic
1091434654 12:462895-462917 CTCTGGAGGGAGAGCCAGGGAGG + Intronic
1092205974 12:6614269-6614291 CAATGGAGAAAGGGCAAGGGAGG - Intergenic
1093467659 12:19466524-19466546 TTCTGGAGACAGAGAGCGGGTGG - Intronic
1094278557 12:28708114-28708136 CTGGGGAGAAAGAGCCATGGGGG + Intergenic
1094480510 12:30877642-30877664 CTCTGGAGAAAGCGTGGGTGGGG - Intergenic
1095943203 12:47739522-47739544 CTCTGCAGAGAGAGAGAGGGAGG - Intronic
1097268055 12:57756908-57756930 CCCTGGAGGAAGAGTGAGGAGGG - Exonic
1097316819 12:58180557-58180579 TTCTGGAGAATGAAGGAGGGTGG + Intergenic
1098267021 12:68732240-68732262 CTCGGGAGACTGAGGGAGGGTGG - Intronic
1099003071 12:77204091-77204113 ATCTAGAGAGAGAGCGAGGTGGG - Intergenic
1100583126 12:95954803-95954825 CTCTGGGGAAAGTGTGATGGTGG - Intronic
1100851400 12:98716115-98716137 CTCTGGAGAACGAGAAATGGGGG - Intronic
1100864347 12:98840478-98840500 ATAGTGAGAAAGAGCGAGGGAGG + Intronic
1101000736 12:100355206-100355228 GTGGGGAGAAAGAGGGAGGGAGG + Intergenic
1102193468 12:111007020-111007042 CTCTGGAGACAGATGGAGAGAGG + Intergenic
1103024550 12:117562996-117563018 CTCTGGAGACAGAGGGAAGAGGG + Intronic
1103952102 12:124556972-124556994 TTCAGGAGAAACAGCGAGGCCGG + Intronic
1106480389 13:30133183-30133205 CTCTGGGGAAAGAGGGTGGCTGG - Intergenic
1107060095 13:36150911-36150933 CTCGGGGGAAAGGGTGAGGGGGG + Intergenic
1107211533 13:37862177-37862199 CTCTAGAGAAAGGGGTAGGGTGG + Intronic
1108141337 13:47425309-47425331 CTGTGGAGAAAGAAAGAGGTGGG + Intergenic
1108562822 13:51663127-51663149 CTTTGGAGACAGAGAGAGAGAGG - Intronic
1108685635 13:52816544-52816566 CTCTGGCCAAACAGCGAGGCTGG + Intergenic
1110704022 13:78584432-78584454 ATATGGAGAAAGAGAGAGAGAGG - Intergenic
1110739956 13:78983304-78983326 CACTGAAGAAAGAGAGAGAGAGG + Intergenic
1112709146 13:102106569-102106591 CTGTCGAAAAAGAGGGAGGGAGG + Intronic
1113377998 13:109782488-109782510 CTCAGGAAAAGCAGCGAGGGCGG - Exonic
1113574915 13:111388517-111388539 TTCTGCATAAAGAGCGAGGCAGG - Intergenic
1114558940 14:23577625-23577647 CTGCGGAGAAAGAGGGAGGGGGG + Intronic
1115007997 14:28510106-28510128 CTCTGCAGCAAGAGAGAGTGCGG - Intergenic
1116769914 14:49115310-49115332 CTCTGGAGAATGAGGGAGTGTGG + Intergenic
1117021964 14:51580030-51580052 GACTGGAGAAAGAGACAGGGAGG + Intronic
1117063221 14:51983612-51983634 ACCTGGGTAAAGAGCGAGGGTGG - Intergenic
1117531648 14:56665728-56665750 ATATGGAGAAAGAGAGAGAGAGG - Intronic
1118145325 14:63128512-63128534 ATCAAGAGAAAGAGAGAGGGAGG - Intergenic
1119024123 14:71139209-71139231 CGCTGGAGAGAGACTGAGGGTGG + Intergenic
1122092956 14:99352137-99352159 GTCTGGAGAGAGAGTGAGGCTGG + Intergenic
1122200845 14:100121657-100121679 CTCTGGAGAAACAGGTTGGGAGG + Intronic
1123213986 14:106789252-106789274 ATATGGAGAGAGAGAGAGGGAGG - Intergenic
1125531176 15:40414552-40414574 CTGTGTAGAAAGAGTCAGGGAGG + Intronic
1126929381 15:53631240-53631262 GGCTGGAGAAGGAGCGAGGGAGG - Intronic
1127003690 15:54541109-54541131 CTCTGGATAAAGAGGAAGGTTGG - Intronic
1127166510 15:56249436-56249458 CTGGGGAGAGAGAGAGAGGGAGG + Intronic
1127773682 15:62249886-62249908 CTCAGGAGAAAGGACCAGGGTGG - Intergenic
1128841050 15:70852331-70852353 TTCTGGAGGAAGAGCAAGAGGGG + Intronic
1129095295 15:73200520-73200542 CTCTAGAGAGAGAGAGAGAGAGG + Intronic
1130883857 15:88077428-88077450 CTCTGGGGTGAGGGCGAGGGTGG - Intronic
1131233077 15:90673627-90673649 CTCTGAAGAAAGAGGGAGGGAGG - Intergenic
1131261523 15:90890396-90890418 CTCAGGAGCAGGAGCGAGAGGGG + Exonic
1131542961 15:93289824-93289846 CTCTGAGGCAAGAGCGAAGGGGG - Intergenic
1131831889 15:96359866-96359888 CCCTGGAGAAAGTGCACGGGAGG + Intergenic
1132201799 15:99960033-99960055 CTTTGGAGACAGAGACAGGGTGG + Intergenic
1132311679 15:100862074-100862096 CCCTGGAGGAAGACAGAGGGTGG + Intergenic
1132515340 16:363385-363407 CACTGGTGAGAGGGCGAGGGCGG + Intergenic
1133164596 16:3937680-3937702 CTCTGGAGATGGAGCTGGGGTGG + Intergenic
1134511362 16:14850338-14850360 TTCTAGAGAAAGAGGGAGGAGGG + Intronic
1134699006 16:16248835-16248857 TTCTAGAGAAAGAGGGAGGAGGG + Intronic
1134972831 16:18545838-18545860 TTCTAGAGAAAGAGGGAGGAGGG - Intronic
1136238882 16:28932323-28932345 CTGTGGAGAGAGAGGGAGAGAGG - Intronic
1137389410 16:48068919-48068941 ATCTGGAGAAAGGAGGAGGGAGG + Intergenic
1138956439 16:61976385-61976407 CAGTCGAGAAAGAGAGAGGGAGG - Intronic
1139396091 16:66640396-66640418 GTCTGGAGAAAGAGCACTGGAGG + Intronic
1140040850 16:71406691-71406713 CTCAGGAGAACCAGGGAGGGAGG - Intergenic
1141261542 16:82458881-82458903 AACTGGACAAAGAGTGAGGGTGG + Intergenic
1141507341 16:84486557-84486579 CTCTGGAGAAAGGGAGAGGGTGG - Intronic
1141775581 16:86120950-86120972 GTGGGGAGAAAGAGAGAGGGAGG - Intergenic
1141888757 16:86912029-86912051 TACTGGAGAAAGAGAGTGGGAGG - Intergenic
1142191586 16:88720650-88720672 CTCTGGAGGAAGAGTAAGGGCGG - Exonic
1142644222 17:1301659-1301681 GTCTGTAGAAGGAGGGAGGGAGG + Intergenic
1142698845 17:1647779-1647801 CTCAGCAGAATGAGGGAGGGAGG + Intronic
1143141286 17:4743282-4743304 CTCTGGAGAAGGAGAAGGGGAGG - Exonic
1143395148 17:6588490-6588512 CTCAGGAGAAAAAGTAAGGGTGG + Intronic
1143447466 17:7017928-7017950 CTGTGGTGTTAGAGCGAGGGTGG - Intergenic
1143483132 17:7238509-7238531 CTGTGGAGAGAGAGAGAGAGTGG - Intronic
1144180392 17:12746153-12746175 ATCTGGAGTAAGAGAGTGGGAGG + Intronic
1145209531 17:21003074-21003096 CTGTGGAGGCAGAGAGAGGGAGG + Intronic
1146459963 17:33038579-33038601 CAGTGGAGAAAGAGTGGGGGAGG - Intronic
1146574409 17:33978833-33978855 CTATGGAGGGAGAGCGAGGAGGG + Intronic
1147188466 17:38725536-38725558 GTCTGGAAAGAGAGGGAGGGAGG - Exonic
1147684744 17:42280392-42280414 CTCTGGGGCAGGAGTGAGGGAGG - Intergenic
1148236443 17:45972245-45972267 CCCTGAAGAAAGAGAGAGGAGGG - Intronic
1148438264 17:47698574-47698596 CTCTGGAGAGAGAGACAGAGGGG - Exonic
1148444797 17:47731043-47731065 CTCTGGAGGAAGAGGAAGGCTGG - Intergenic
1148994349 17:51696176-51696198 CTTTGTAGAAAGAGTTAGGGAGG + Intronic
1150102367 17:62434875-62434897 GTGTGGAGAAAGTGCCAGGGTGG + Intronic
1150326417 17:64262279-64262301 CTCTGGAGAAAGAGCGAGGGTGG + Intronic
1150485295 17:65538959-65538981 TTCTGTACAAAGAGAGAGGGAGG - Intronic
1151137988 17:71966130-71966152 GTCTGGAGAGAGAGAGAGAGTGG - Intergenic
1151491440 17:74434020-74434042 CCCTGGAGAGAGAAGGAGGGAGG + Intronic
1151852746 17:76700800-76700822 CACTGGAGAGAGAGAGAGAGTGG + Intronic
1152251547 17:79215150-79215172 CTCTGGGGGAAGTGGGAGGGAGG + Intronic
1152414728 17:80152101-80152123 CTCTGGGGCAAGAGAGAGGGAGG + Intergenic
1152595704 17:81236648-81236670 CTTTGGAGAATGGGGGAGGGTGG - Intronic
1152804159 17:82347222-82347244 CTCTGGAGACAGAGAGACTGAGG + Intergenic
1152804195 17:82347352-82347374 CTCTGGAGACAGAGAGACAGAGG + Intergenic
1152804232 17:82347480-82347502 CTCTGGAGACAGAGAGACTGAGG + Intergenic
1152804244 17:82347526-82347548 CTCTGGAGACAGAGAGACTGAGG + Intergenic
1152804279 17:82347655-82347677 CTCTGGAGACAGAGAGACAGAGG + Intergenic
1152804304 17:82347741-82347763 CTCTGGAGACAGAGAGACTGAGG + Intergenic
1152804316 17:82347787-82347809 CTCTGGAGACAGAGAGACTGAGG + Intergenic
1152804328 17:82347833-82347855 CTCTGGAGACAGAGAGACAGAGG + Intergenic
1152804365 17:82347961-82347983 CTCTGGAGACAGAGAGACTGAGG + Intergenic
1152804377 17:82348005-82348027 CTCTGGAGACAGAGAGACTGAGG + Intergenic
1153718931 18:7881600-7881622 CTCTGAAGAAAGAGAGAGCAGGG - Intronic
1153769005 18:8400613-8400635 CTCTGGAGTAAGTGGGACGGAGG - Intronic
1155227117 18:23738358-23738380 CTCTCCAGAAGGAGGGAGGGAGG - Intronic
1155239952 18:23855458-23855480 TTCTGGAGAGACAGCGAGTGTGG - Intronic
1155663356 18:28278101-28278123 GTCAAGAGAAAGAGCGAGAGAGG - Intergenic
1157854016 18:51087371-51087393 ACCTGGAAAAAGAGCGAGGCTGG + Intergenic
1157872974 18:51247343-51247365 CTCTGGAGCAAGAGGAATGGGGG + Intergenic
1158586082 18:58736345-58736367 CTCTGGATGAAGCGGGAGGGTGG - Intronic
1159225980 18:65536630-65536652 CTCAGGAGAAAGGGTGAGAGGGG + Intergenic
1160074120 18:75655590-75655612 CTCTGGAGGAGGAGCGGGAGGGG + Intergenic
1160671781 19:368468-368490 CTCTGGGGAGGGAGGGAGGGAGG + Intronic
1160947007 19:1648337-1648359 CTCTGGGTAAAGCCCGAGGGGGG + Intronic
1161333520 19:3699359-3699381 GTCTGGAGAGAGAGAGAGTGTGG - Intronic
1161546694 19:4885264-4885286 CCCTGCAGCAAGAGGGAGGGAGG + Intergenic
1161546788 19:4885829-4885851 CCCTGCAGCAAGAGGGAGGGAGG + Intergenic
1161821587 19:6533667-6533689 CTCTGGAGGGAGAGGGAAGGGGG - Intronic
1162304478 19:9863406-9863428 CTCTAGGGAACGAGGGAGGGAGG + Intronic
1164227535 19:23258906-23258928 CTCTGTAGAAAGAGCCCAGGTGG + Intergenic
1164399089 19:27890525-27890547 CTCTGGAGTAAGAGCCTGAGAGG - Intergenic
1164475027 19:28569115-28569137 CCCTGGAGAAAGAGAGAGATGGG + Intergenic
1165102903 19:33449359-33449381 CTGTGCAGAAAGAGCCAGAGAGG + Intronic
1165112460 19:33510344-33510366 ATATGGAGACAGAGGGAGGGGGG + Intronic
1166268143 19:41697368-41697390 ATCTGGAGAAAGACCCAGAGTGG - Intronic
1166325872 19:42050870-42050892 CTCAGGAGAGGGAGGGAGGGAGG + Intronic
1166431056 19:42728563-42728585 CTGTGGAGAAAGAGCCCTGGTGG - Intronic
1166816087 19:45547069-45547091 CTATGGGGAAGGAGGGAGGGAGG + Intronic
1167117277 19:47495595-47495617 CTCTGGAGAGAAAGGGAGGTGGG + Exonic
1167220933 19:48197509-48197531 TTCTGAAGAGAGAGGGAGGGCGG + Exonic
1167521038 19:49955270-49955292 ATCTGGAAAAAGAGCGGGGCGGG + Intronic
1167934823 19:52897448-52897470 CACTGCAGAAAGACCGAGGACGG + Intronic
1168060461 19:53889305-53889327 CTCTGGAGAAAAAATGAGGCAGG - Intronic
1168083772 19:54029928-54029950 CACTGGAGAGAGAGGGTGGGAGG + Intergenic
1168148152 19:54430792-54430814 CTCTGCAGAAAGAGAAAGGGAGG - Exonic
1168345732 19:55649387-55649409 CTCTAGGGACACAGCGAGGGTGG - Exonic
925090524 2:1151481-1151503 TCCTGCAGAAAGAGCGAGGCTGG - Intronic
926145150 2:10392787-10392809 CTCTGGAGAATGGCAGAGGGAGG - Intronic
926179405 2:10627735-10627757 TTTTGGAGAGAGAGGGAGGGAGG + Intronic
927234281 2:20856110-20856132 GTCTGAAGGAAGAGTGAGGGAGG - Intergenic
927849935 2:26492680-26492702 CTCTGAACAAATAGCGAGGCAGG + Intronic
928094402 2:28394769-28394791 CTCTCGAGACAGAGCGGGTGGGG - Intronic
928899829 2:36304972-36304994 CATGGGAGGAAGAGCGAGGGAGG - Intergenic
928941690 2:36733345-36733367 GTCTGGAGAGAGAGAGAGGGGGG - Intronic
929143305 2:38685249-38685271 CTCTGGAAATGGAGCGGGGGTGG + Intronic
929654306 2:43715337-43715359 CTTTGGAGAAAAAGCTAGAGGGG + Intronic
930047013 2:47181332-47181354 CTTTGGTGACAGAGTGAGGGAGG - Intergenic
931205385 2:60140958-60140980 TTCTGGAGGAGGAGAGAGGGGGG - Intergenic
931528223 2:63182651-63182673 CTCTGTAGAATGAGTCAGGGAGG + Intronic
931563589 2:63589769-63589791 CTCTGCTGAAAGAGAGGGGGAGG + Intronic
931690806 2:64833498-64833520 CAGTTGAGAAAGAGAGAGGGAGG + Intergenic
931868243 2:66434057-66434079 CGCTGGAGAAAGAGCTAGTGGGG + Intronic
934780626 2:96967597-96967619 CCCTGGAGCAGGAGCGAGAGAGG - Exonic
935121093 2:100184372-100184394 CTTTGGAGAGAGAGAGAGAGCGG + Intergenic
935785769 2:106547394-106547416 GTCTGGAGACAGAGAGAGAGAGG + Intergenic
935882917 2:107584355-107584377 CACTGGAGAAAGATGGAGGCCGG + Intergenic
936475204 2:112833574-112833596 CACTGCGGAGAGAGCGAGGGAGG + Exonic
937815213 2:126243745-126243767 CTCCGGACAAAGAGCAAGGCAGG - Intergenic
938402042 2:131001892-131001914 CTCTGGAGAGGAAGCTAGGGAGG + Intronic
939219829 2:139287437-139287459 CTCAGGAGAAAGAGCGGGGGTGG + Intergenic
939456324 2:142441564-142441586 CACGGGAGACAGAGCGATGGGGG - Intergenic
939660419 2:144882085-144882107 CTCTGGAGCAACAGCGTAGGTGG - Intergenic
940274304 2:151923023-151923045 CTCTGAAGAAACAGCAAGGCTGG + Intronic
940792316 2:158042315-158042337 CTCAGGAAAAAAAGCGAGGGGGG - Intronic
943722943 2:191223687-191223709 CCATGGAAAAAGAGAGAGGGAGG + Intergenic
944521471 2:200573597-200573619 CTCTGGAGAAGGATCTATGGAGG - Exonic
946180513 2:217946203-217946225 GTCTGGAGAAGGATCCAGGGAGG - Intronic
946580082 2:221119011-221119033 ATGTAGAGAAAGAGGGAGGGTGG - Intergenic
946750864 2:222895320-222895342 CTCTGGAGGAGGAGAGAGGGTGG - Intronic
947858033 2:233337689-233337711 CTCTGGAAAAAGAGTTGGGGCGG - Intronic
1168790385 20:572199-572221 CCCTGGAGAAAGAGGGTGAGCGG + Intergenic
1168874813 20:1164249-1164271 CCTTGGAGAAAAGGCGAGGGAGG - Intronic
1169900691 20:10549259-10549281 CACTGTAGAAAGAACGAGGTGGG - Intronic
1170481779 20:16773195-16773217 AGCTGGAGAAAGAGAGAGTGAGG - Intergenic
1171242843 20:23585811-23585833 TTCTGAAGAAAGAGCGTGGTGGG + Intergenic
1171278463 20:23877932-23877954 CTCTGGGGAACCAGCCAGGGTGG + Intronic
1173925560 20:46778705-46778727 CTTTGCAGGAAGAGGGAGGGAGG - Intergenic
1174582464 20:51581724-51581746 CTGTGGAGTCAGAGAGAGGGAGG - Intergenic
1174630626 20:51953876-51953898 CTTTGTACAAAGAGAGAGGGAGG - Intergenic
1174995514 20:55563305-55563327 CTCTGTAGAATGAGTTAGGGAGG + Intergenic
1175010969 20:55735628-55735650 CTCAGGAGAAAGAGGAAGGATGG - Intergenic
1175084585 20:56447735-56447757 AGCTGGAGCAAGAGCCAGGGAGG - Intronic
1175149302 20:56920572-56920594 ATCTGGAGAAGGGGTGAGGGAGG + Intergenic
1175198328 20:57261622-57261644 CTCTGCAGAAAGAAAGAAGGGGG + Intronic
1175647641 20:60688357-60688379 CTCTGGCGAGAGAAAGAGGGAGG - Intergenic
1175653790 20:60751210-60751232 ATCTGGAGAAATACCGAGAGTGG - Intergenic
1175839282 20:62016462-62016484 CTCTGGAGAAAGATGGAGGCCGG - Intronic
1176794433 21:13360418-13360440 CTTCGGAGATATAGCGAGGGCGG - Intergenic
1176969898 21:15253203-15253225 CACTGGAGAAAGATGTAGGGTGG + Intergenic
1177085113 21:16694160-16694182 GACAGGAGAGAGAGCGAGGGAGG + Intergenic
1177319449 21:19501142-19501164 CAAAGGAGAAAGAGAGAGGGGGG + Intergenic
1183756320 22:39769570-39769592 CTCTGGAGAAAGCTCCGGGGTGG + Intronic
1184067397 22:42128496-42128518 CTCTGGGCAAGGAGAGAGGGTGG - Intronic
1184402625 22:44282592-44282614 CGCAGGAGAAAGAGCTGGGGTGG + Intronic
950306202 3:11916931-11916953 CTCAGGAGAAAGATCGAGCTGGG + Intergenic
950443603 3:13023571-13023593 GTCTGCAGAAACAGGGAGGGTGG + Intronic
950545069 3:13633422-13633444 GTCTGGAGAGCAAGCGAGGGCGG - Intronic
950996651 3:17505320-17505342 CTCAGGAGTAAGAGAGATGGTGG - Intronic
952721826 3:36541646-36541668 CTCTGGAGAATGAGATTGGGAGG + Intronic
953564221 3:44017143-44017165 CTCTGGAGAAAGAGTGGATGTGG - Intergenic
953605253 3:44409616-44409638 CTTTGTAGAAACAGTGAGGGGGG - Intergenic
954001921 3:47564416-47564438 CTCTGGAGAAGCACCGAGTGAGG - Intronic
954769638 3:52954886-52954908 GTATGGAGAAAAAGGGAGGGGGG - Intronic
955740520 3:62086332-62086354 CTCTGGAGAGAGAGAGAGAAGGG + Intronic
956381809 3:68672274-68672296 CTCAAGAGAAAGACTGAGGGAGG - Intergenic
957503548 3:81090226-81090248 CTCTAGAGAGAGAGAGAGAGAGG - Intergenic
960945533 3:122963955-122963977 CCCTGGGGAGAGAGGGAGGGAGG - Intronic
961636189 3:128334727-128334749 TTCTGGGGAAGGAGGGAGGGAGG - Intronic
962629577 3:137262856-137262878 CTCTGGAGAATGTGACAGGGTGG - Intergenic
963020686 3:140870159-140870181 CTCTGGAGAAAGAGGGGGAAGGG + Intergenic
963741684 3:149087284-149087306 CTCTGGAAAGAGAGCCATGGAGG - Intergenic
967930496 3:194687112-194687134 ATCTGGAGCAAGAGCGAGGCGGG + Exonic
969596820 4:8153880-8153902 CTCTACAGAAACAGTGAGGGAGG - Intronic
969948413 4:10808111-10808133 CTCTGGAGACTGAGCAAGGTAGG - Intergenic
970210578 4:13705934-13705956 CTCTGGAGAAAGAGCGAAGCAGG - Intergenic
971197076 4:24479716-24479738 CTGTTGAGAGAGAGAGAGGGAGG - Intergenic
973749520 4:53999616-53999638 CTCTGAAGAAAGCGTGGGGGAGG - Intronic
975693949 4:76993220-76993242 CTCTGGAGAAGGGGCGAGTTTGG + Intronic
975955732 4:79835896-79835918 CTCAGGAGAAAGGGTGAGAGGGG - Intergenic
977095131 4:92733087-92733109 CACTGGAGAGAGAGAGAGAGAGG - Intronic
981130136 4:141149384-141149406 CTCTGGGGAAAGAGTGGGAGGGG - Intronic
981250352 4:142593683-142593705 CTATGGAGAAAGAGAGAAAGTGG - Intronic
982569400 4:157029353-157029375 GTCTTGAGAGAGAGAGAGGGAGG + Intergenic
982830263 4:160050660-160050682 CTCTGGGGAAAGAGTGGGAGGGG + Intergenic
984693423 4:182754791-182754813 ATCTGGAGAAGCAGCCAGGGAGG - Exonic
984812114 4:183804404-183804426 TGCTGGAGAAACAGAGAGGGTGG + Intergenic
985491401 5:181827-181849 CTCTGCAGGATGAGTGAGGGCGG - Intronic
986012788 5:3731779-3731801 CTTTGGAGAAAGAGCTGGGTGGG + Intergenic
986822347 5:11481594-11481616 CCCTGGAGAGAGGGAGAGGGAGG + Intronic
990053099 5:51532637-51532659 CTCTGCAGAAACAATGAGGGCGG + Intergenic
990389861 5:55307789-55307811 CAGTGGATAAAGAGCGAGGGCGG - Exonic
991015697 5:61929922-61929944 CTCTGGGGAAAAAGGGTGGGAGG - Intergenic
991335127 5:65538646-65538668 CTCTGCAGACAGAGCGATGGAGG + Intronic
991928451 5:71728138-71728160 CTCTGGGGAAACAGGGATGGTGG - Intergenic
993083984 5:83340286-83340308 CTCTGGGGGAAGAGGGTGGGTGG - Intronic
998658266 5:144206308-144206330 CTCTGGAGAGAGAGAGAGGGAGG - Intronic
998917584 5:147032506-147032528 CTCGGGGGAAAGAGGGAGAGGGG - Intronic
1000911739 5:167030855-167030877 CCCTGCAGAAAGTGAGAGGGAGG - Intergenic
1002163415 5:177330769-177330791 CTCTGGAGAATGAGAGACAGAGG + Intergenic
1002317269 5:178351219-178351241 CTCTAGAGAAAGATCTAGGTGGG + Intronic
1002895775 6:1379302-1379324 TTCTGGAGCAGGAGGGAGGGTGG + Intergenic
1003500142 6:6696476-6696498 CTCTGAGGAAAGAGCGTGGCGGG + Intergenic
1004070888 6:12296355-12296377 CTCCGGAGAGAGAGAGAGGAAGG + Exonic
1004123564 6:12850363-12850385 CCCTGGAGCAAGAGTGAAGGAGG - Intronic
1004503515 6:16229340-16229362 ATCTGGAAAAAGAGGGAGGCAGG - Intergenic
1006456043 6:34132618-34132640 TTCTGGAGAACGACAGAGGGAGG - Intronic
1006458648 6:34145581-34145603 CGCTGGAGAGCGAGCGAGAGAGG + Intronic
1007340766 6:41190209-41190231 ATCTGGAGAAGGAGTGAGAGAGG - Intergenic
1009876404 6:69511348-69511370 CTCTGGAGAAAGTGCTATGGTGG - Intergenic
1010001900 6:70956760-70956782 CTCTTCAGAAAGAGCGCGGTGGG - Exonic
1010517831 6:76795448-76795470 CTCTGGAAAAAGAGCAATGGGGG - Intergenic
1010988768 6:82455893-82455915 CTTTGTAGAATGAGCTAGGGAGG + Intergenic
1013231411 6:108164952-108164974 GTCTGGAGAAAGAGGGACCGGGG + Intronic
1013720233 6:113016791-113016813 CTCTGGAGAAAGAGTTATTGAGG + Intergenic
1015980276 6:138831418-138831440 CTATGGAGAAAGAGGGAAGAGGG - Intronic
1017332815 6:153219280-153219302 CTCAGGAGAAAGAGTGAGATGGG + Intergenic
1017927224 6:158921132-158921154 CTCAGGAGAAACAGGGATGGTGG - Intergenic
1017989320 6:159472400-159472422 ATCAGGAGGAAGAGAGAGGGGGG + Intergenic
1019018418 6:168897339-168897361 CTGTGGAGAAAGAGACAGAGAGG - Intergenic
1021316009 7:19147872-19147894 CTCTGTTGAAAGAGAGAAGGAGG - Intergenic
1021939393 7:25664707-25664729 CTTTGAAGAAAGAGCAAAGGAGG - Intergenic
1022540328 7:31128957-31128979 CTGTGGAGAAAAAGGGAGGAGGG - Intergenic
1023155534 7:37247820-37247842 CTCTGGGAAAAGAGCAAGAGGGG + Intronic
1023282315 7:38583781-38583803 CCCTGGAGGCAGAGTGAGGGGGG + Intronic
1023978376 7:45050888-45050910 CTCAAGAGAAAGAGTGAAGGGGG + Intronic
1023992753 7:45139212-45139234 CTGGGGAGACAGAGAGAGGGCGG - Intergenic
1024228118 7:47343903-47343925 CTATGGAGAAAGAGAGAGAATGG + Intronic
1026238165 7:68547270-68547292 CTTTGGAGAGAGAGCCGGGGTGG - Intergenic
1026899217 7:74027831-74027853 CCCGCCAGAAAGAGCGAGGGGGG - Intronic
1026933223 7:74236682-74236704 CCCTGGAGAAGGAGCTAGGCTGG + Intronic
1027234022 7:76287222-76287244 CTGCGGAGAAAGAGGGAGGGGGG - Exonic
1028883729 7:95909212-95909234 CTCTGGAGAAACTTGGAGGGTGG + Intronic
1029745434 7:102513424-102513446 ATCTGGGGAAAGAGGGATGGGGG + Intronic
1029763373 7:102612403-102612425 ATCTGGGGAAAGAGGGATGGGGG + Intronic
1030341504 7:108385896-108385918 CTATGGAGAGAGAGGGAGGGAGG + Intronic
1031988222 7:128177725-128177747 CTCTGGAGGCAGAGCGAGCCTGG + Intergenic
1032441703 7:131947268-131947290 CTCTGGAGAAGGAAAGAAGGAGG + Intergenic
1032846801 7:135758244-135758266 CTCAGGAGAAATAGTCAGGGAGG + Intergenic
1034715865 7:153240844-153240866 CTCGGGAGAAAGGGTGGGGGAGG - Intergenic
1035049786 7:155992157-155992179 CCCTGGAGAAATAGCTGGGGAGG + Intergenic
1035109133 7:156465477-156465499 CTGTGGAGAGAGACCGAGGCAGG - Intergenic
1036783210 8:11664778-11664800 CTCAGAAGAAAGAGGGAGGTAGG - Intergenic
1037485041 8:19339161-19339183 CACAGGAGAAAGATGGAGGGTGG + Intronic
1037613851 8:20499430-20499452 TTCTAGAGAAAGAGCCAAGGAGG + Intergenic
1038279908 8:26154498-26154520 TTGTGGAGAAAGAGGAAGGGAGG + Intergenic
1039662045 8:39478382-39478404 CTCTGCAGAAAGGAAGAGGGAGG - Intergenic
1039818515 8:41115784-41115806 ATCTGGAGAAAGAGCAAGAGTGG - Intergenic
1039828151 8:41192194-41192216 CCCGGGAGAAAGAGGGAGTGAGG - Intergenic
1041272791 8:56125276-56125298 CTTTGGATAAATAGCGAGTGTGG + Intergenic
1043035871 8:75198159-75198181 ATCTGGAGAAAGTGCGTGTGTGG - Intergenic
1044924132 8:97195449-97195471 CTCTGGACACAGAGTGAGGCTGG + Intergenic
1045264368 8:100606653-100606675 CTCAGGAGAGAGAGAGATGGTGG - Intronic
1045855690 8:106762950-106762972 CTGGGGAGAAAAAGGGAGGGTGG - Intronic
1045932750 8:107646348-107646370 CACTGGAGAAAGATCAAGGCCGG + Intergenic
1046367203 8:113250387-113250409 CTCTCAAGAAAGAGAGATGGAGG + Intronic
1048259073 8:132930435-132930457 CTTTGGAGACTGAGCGGGGGTGG + Intronic
1048845079 8:138598225-138598247 CTTTGGAGAAAGAGAGACGCAGG + Intronic
1048870851 8:138796610-138796632 CTCAGCAGAAAGAGAGAAGGTGG - Intronic
1049020957 8:139957428-139957450 CTCTGGAGTCAGAGAGAGGCAGG + Intronic
1049191640 8:141291304-141291326 GTCTGGAGAAAGAGGGCTGGGGG + Intronic
1049791766 8:144475544-144475566 GTCTGGGGAAAGAGAGAGTGGGG + Intronic
1050427260 9:5523940-5523962 CTCTGTAGAAAGAGCCAATGAGG - Intronic
1052823823 9:33161066-33161088 CTCTGGAGAAGCAGCGGGTGTGG + Intronic
1053144432 9:35702930-35702952 GACTGGAGAAAGTGGGAGGGTGG + Intronic
1053350464 9:37410530-37410552 AGCTGGAGACAGAGGGAGGGAGG + Intergenic
1056512240 9:87316947-87316969 CTCTGGACAAACACCGATGGTGG - Intergenic
1058321770 9:103641017-103641039 CACAGGAGCAAGAGAGAGGGAGG + Intergenic
1059739707 9:117137675-117137697 TTCAAGAGAAAGAGGGAGGGTGG + Intronic
1060207095 9:121688537-121688559 CTCTGGAGACAGAGAGAGATGGG - Intronic
1060231427 9:121828113-121828135 CTGTGGACAAAGAGTAAGGGTGG - Intronic
1060656166 9:125374188-125374210 CTCTGGAGAGGGAGGGATGGGGG - Intergenic
1061633588 9:131890426-131890448 CTTCGGAGAAAGAGAGAGGCCGG + Intronic
1062484066 9:136765393-136765415 CTCTGGAGTGAGAGTGAGGCAGG + Intronic
1185545478 X:940665-940687 TTCTGCAGACAGAGAGAGGGAGG - Intergenic
1186953742 X:14657083-14657105 CGCTAGACAAAGAGCAAGGGTGG + Intronic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187768331 X:22667775-22667797 GGCTGGAGAAGGAGCGAGGTGGG - Intergenic
1188522439 X:31053746-31053768 CTGAGGAGAGAGAGGGAGGGAGG - Intergenic
1191899038 X:66022454-66022476 CTCTGGAGAAACCATGAGGGTGG - Exonic
1192362406 X:70448037-70448059 CCCAGCAGAAAGGGCGAGGGTGG - Intronic
1192672766 X:73163664-73163686 CTCAGGGGAAAGAGTGAGGGGGG - Intergenic
1192689171 X:73342818-73342840 CTCTGAAGAAAGAAGGAGTGGGG + Intergenic
1193165661 X:78277345-78277367 ATCTGGTGAAAGAGCTATGGTGG - Intronic
1195884298 X:109624053-109624075 CCCTGCTGAAAGAGAGAGGGAGG + Exonic
1197710219 X:129660680-129660702 AGCAGGAGAAAGAGAGAGGGAGG + Intergenic
1200941284 Y:8784394-8784416 CTCTGAAGAAACTGCGAGGCTGG + Intergenic