ID: 1150327394

View in Genome Browser
Species Human (GRCh38)
Location 17:64268144-64268166
Sequence GAGTAGCCCTGGGCCAGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150327387_1150327394 1 Left 1150327387 17:64268120-64268142 CCAAGGAGTCCCAAGGGGACAAG No data
Right 1150327394 17:64268144-64268166 GAGTAGCCCTGGGCCAGGGTAGG No data
1150327388_1150327394 -8 Left 1150327388 17:64268129-64268151 CCCAAGGGGACAAGAGAGTAGCC No data
Right 1150327394 17:64268144-64268166 GAGTAGCCCTGGGCCAGGGTAGG No data
1150327389_1150327394 -9 Left 1150327389 17:64268130-64268152 CCAAGGGGACAAGAGAGTAGCCC No data
Right 1150327394 17:64268144-64268166 GAGTAGCCCTGGGCCAGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150327394 Original CRISPR GAGTAGCCCTGGGCCAGGGT AGG Intergenic
No off target data available for this crispr