ID: 1150328352

View in Genome Browser
Species Human (GRCh38)
Location 17:64274646-64274668
Sequence CCTGGTTTCCGGAGGCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150328344_1150328352 -5 Left 1150328344 17:64274628-64274650 CCAGACTTTAGGAAGCCACCTGG No data
Right 1150328352 17:64274646-64274668 CCTGGTTTCCGGAGGCTGGGAGG No data
1150328343_1150328352 -4 Left 1150328343 17:64274627-64274649 CCCAGACTTTAGGAAGCCACCTG No data
Right 1150328352 17:64274646-64274668 CCTGGTTTCCGGAGGCTGGGAGG No data
1150328342_1150328352 1 Left 1150328342 17:64274622-64274644 CCTGTCCCAGACTTTAGGAAGCC No data
Right 1150328352 17:64274646-64274668 CCTGGTTTCCGGAGGCTGGGAGG No data
1150328340_1150328352 22 Left 1150328340 17:64274601-64274623 CCTCATTAAACTAAGAAGGTACC No data
Right 1150328352 17:64274646-64274668 CCTGGTTTCCGGAGGCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150328352 Original CRISPR CCTGGTTTCCGGAGGCTGGG AGG Intergenic
No off target data available for this crispr