ID: 1150331150

View in Genome Browser
Species Human (GRCh38)
Location 17:64295344-64295366
Sequence CACAATTAGCTGTATGACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150331148_1150331150 1 Left 1150331148 17:64295320-64295342 CCTGAGCTGGAGTCTCAGATCTG No data
Right 1150331150 17:64295344-64295366 CACAATTAGCTGTATGACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150331150 Original CRISPR CACAATTAGCTGTATGACCT TGG Intergenic
No off target data available for this crispr