ID: 1150335370

View in Genome Browser
Species Human (GRCh38)
Location 17:64326748-64326770
Sequence ACACGCTCACATCCAAGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 68}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150335367_1150335370 3 Left 1150335367 17:64326722-64326744 CCTTAGGGATTTTGAAGTAAAGG 0: 1
1: 0
2: 2
3: 17
4: 196
Right 1150335370 17:64326748-64326770 ACACGCTCACATCCAAGGTCTGG 0: 1
1: 0
2: 0
3: 7
4: 68
1150335365_1150335370 18 Left 1150335365 17:64326707-64326729 CCACAATCAACAGGGCCTTAGGG 0: 1
1: 0
2: 0
3: 8
4: 80
Right 1150335370 17:64326748-64326770 ACACGCTCACATCCAAGGTCTGG 0: 1
1: 0
2: 0
3: 7
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150335370 Original CRISPR ACACGCTCACATCCAAGGTC TGG Intronic
900174238 1:1284804-1284826 ACACGCGCACATGCAGGGTGGGG + Intronic
903639416 1:24848354-24848376 ACCCGCTCACACCCTAGGTGGGG + Intergenic
905178867 1:36154941-36154963 ATACGCACACATCCCAGGACAGG + Intronic
906491608 1:46273069-46273091 ACACGCTCATATACAATGTTGGG + Intronic
909708664 1:78618026-78618048 CCACAGTCACATCCATGGTCTGG + Intergenic
911496962 1:98643692-98643714 ACACACACACATCCCATGTCAGG - Intergenic
916485077 1:165251397-165251419 ACACGGTAATATCCAAGTTCTGG + Intronic
916614687 1:166427983-166428005 ACAGGCTAACATCCAAATTCAGG - Intergenic
921390169 1:214607804-214607826 CCCAGCACACATCCAAGGTCTGG - Intronic
922915240 1:229252137-229252159 ACACCCTCCCATCCAGGGCCAGG + Intergenic
923369798 1:233298508-233298530 TCACGCTCACCTCCATGGCCAGG - Intergenic
924175990 1:241391482-241391504 AGCAGCTCACATCCAATGTCTGG + Intergenic
1064003663 10:11683636-11683658 ACACGCACACATCCAGTGGCAGG + Intergenic
1074141232 10:110674697-110674719 TCAAGATCACATACAAGGTCTGG + Intronic
1085823351 11:79816983-79817005 ACATGCTCCCAGCCAATGTCTGG + Intergenic
1100213377 12:92421672-92421694 GCCCACTCACATCCAAGGGCAGG - Intronic
1102897681 12:116611662-116611684 ACAAGCTCACATTCCAGGACGGG + Intergenic
1106132536 13:26952112-26952134 CCAAGATCACAGCCAAGGTCAGG + Intergenic
1108479409 13:50853235-50853257 ACACACACACACACAAGGTCTGG + Intergenic
1118919458 14:70136822-70136844 CCAGGCTCACAGCCAGGGTCTGG + Intronic
1122143224 14:99674639-99674661 TCACCCTCACAACCAAGGCCTGG + Intronic
1123872930 15:24594687-24594709 ACATGATCACCTCTAAGGTCTGG + Intergenic
1129240623 15:74249958-74249980 ACAGGCTAACATTTAAGGTCAGG - Intronic
1131261711 15:90891179-90891201 CCCCACTCACATCCAAGGACTGG - Exonic
1134099346 16:11440718-11440740 ACAACGTCACATCCCAGGTCAGG - Exonic
1137553469 16:49455827-49455849 CCACCCTCCCATCCAAGGCCTGG - Intergenic
1146913125 17:36660710-36660732 ACAGGCTCCGATCCTAGGTCAGG + Intergenic
1150335370 17:64326748-64326770 ACACGCTCACATCCAAGGTCTGG + Intronic
1158830485 18:61272122-61272144 ACACACACACATACATGGTCTGG + Intergenic
1160024673 18:75208311-75208333 ACACCCACACATCCAACGACAGG + Intronic
1160209686 18:76866487-76866509 ACACGCTGCCATCCGAGGGCCGG + Intronic
1162759168 19:12878425-12878447 TCACACTCACATCCCAGGCCGGG - Exonic
925572712 2:5329082-5329104 AGACGCTGAAATCCAAGGTCAGG + Intergenic
931251037 2:60530740-60530762 ACACGCTCTCATCTAAAGCCTGG + Intronic
934551678 2:95266806-95266828 AGACGCTCCCTGCCAAGGTCTGG - Intergenic
938144910 2:128825303-128825325 ACAGGCCCACATTCAAGTTCAGG + Intergenic
941339980 2:164295011-164295033 ACACCCCCAAATCCAAGTTCTGG + Intergenic
944150314 2:196551294-196551316 ACACACTTACAGCCAAGGACAGG + Intronic
945291692 2:208133705-208133727 ACACACTCACATTGAAGTTCAGG + Intergenic
948808786 2:240464730-240464752 ACACGCTCACGGCCAAGGTGCGG + Exonic
1170135309 20:13067322-13067344 ACAAGCTGACATTCAAGGTGAGG - Intronic
1173428087 20:42959978-42960000 TCACTCTCACCTCCAAGGGCTGG + Intronic
1175958872 20:62625047-62625069 ACACGCTCACCTGCCTGGTCCGG - Intergenic
1178747737 21:35269471-35269493 ACCCTCTCACAACCATGGTCAGG + Intronic
1181051058 22:20238528-20238550 AGGCGCTCCCATCCAAGGACAGG + Intergenic
1183255109 22:36756999-36757021 ACACGGTGTCAGCCAAGGTCAGG - Intergenic
1184008619 22:41729763-41729785 CCACGCTGACATCCCAGGTAGGG + Exonic
1185054200 22:48569578-48569600 CCATGCACACAGCCAAGGTCGGG - Intronic
1185254176 22:49823037-49823059 TCAGGTCCACATCCAAGGTCAGG - Exonic
1185275174 22:49947621-49947643 ACAAGCTCAGCTCCAAGGGCTGG - Intergenic
951635841 3:24775238-24775260 ACACGCTCAAATCTAACATCAGG + Intergenic
954954976 3:54510981-54511003 ACACGCTCACAAACCAGCTCTGG + Intronic
968745576 4:2358183-2358205 ACACGCACACAGCCATGGACAGG - Intronic
988702154 5:33686127-33686149 TCACCCTCACACACAAGGTCAGG - Intronic
990087532 5:51997126-51997148 ACACACACACATGCAAAGTCTGG - Intergenic
992714917 5:79500980-79501002 ACACACACACACACAAGGTCTGG + Intronic
998963053 5:147509294-147509316 ACACGCGCGAATCCAGGGTCTGG + Intronic
1002442331 5:179270917-179270939 CCACGCTCACATCCACAGCCTGG + Intronic
1005170784 6:22981923-22981945 ACAGGCTGACATGCAAGTTCAGG + Intergenic
1015496922 6:133891798-133891820 AGACTCGCACCTCCAAGGTCAGG - Exonic
1019071734 6:169352395-169352417 ACAGGCCCACATTCAAGTTCAGG - Intergenic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1030519353 7:110578565-110578587 ACACGCTCACGTGTAAGGACTGG - Intergenic
1036760179 8:11503308-11503330 ACAAGCTCCCATCCAAGATCAGG - Intronic
1038595799 8:28884940-28884962 ACACTCTCAGATCCAAGGTGAGG + Intronic
1042743354 8:72075843-72075865 ACACACTCACATGCAAGGTTGGG - Intronic
1043025112 8:75057308-75057330 ACAGGCTAACATTCAAGTTCAGG + Intergenic
1043259526 8:78179557-78179579 ACTGGCTCCCATCTAAGGTCAGG - Intergenic
1044540606 8:93404776-93404798 AAACGCTCCCATCCAAGGTAGGG + Intergenic
1052167790 9:25354881-25354903 ACTGTCTCACATCCAAGGTCAGG - Intergenic
1058448153 9:105071940-105071962 ACACTCCCAGATCCAAGATCTGG + Intergenic
1061284597 9:129614948-129614970 ACACCATTACATCCAGGGTCTGG + Intronic
1186009154 X:5109360-5109382 ATAGGTTCCCATCCAAGGTCTGG + Intergenic
1187370907 X:18705342-18705364 ACAAGATCAGATCCAAGGGCAGG - Intronic
1189071523 X:37868572-37868594 AAACGCTCATATCCAAGGGATGG + Intronic
1192320134 X:70084053-70084075 ACAGGCACACACACAAGGTCAGG + Intergenic