ID: 1150336472

View in Genome Browser
Species Human (GRCh38)
Location 17:64334221-64334243
Sequence AGAGCTGGGCGCTGGCCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 8, 3: 24, 4: 264}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150336472_1150336484 6 Left 1150336472 17:64334221-64334243 CCCCCGGGCCAGCGCCCAGCTCT 0: 1
1: 0
2: 8
3: 24
4: 264
Right 1150336484 17:64334250-64334272 TCGGCCCTGGGGCTGCTCCTTGG 0: 1
1: 0
2: 5
3: 23
4: 293
1150336472_1150336485 9 Left 1150336472 17:64334221-64334243 CCCCCGGGCCAGCGCCCAGCTCT 0: 1
1: 0
2: 8
3: 24
4: 264
Right 1150336485 17:64334253-64334275 GCCCTGGGGCTGCTCCTTGGAGG 0: 1
1: 0
2: 1
3: 58
4: 397
1150336472_1150336488 13 Left 1150336472 17:64334221-64334243 CCCCCGGGCCAGCGCCCAGCTCT 0: 1
1: 0
2: 8
3: 24
4: 264
Right 1150336488 17:64334257-64334279 TGGGGCTGCTCCTTGGAGGCAGG 0: 1
1: 0
2: 7
3: 43
4: 350
1150336472_1150336482 -5 Left 1150336472 17:64334221-64334243 CCCCCGGGCCAGCGCCCAGCTCT 0: 1
1: 0
2: 8
3: 24
4: 264
Right 1150336482 17:64334239-64334261 GCTCTCTCTCCTCGGCCCTGGGG 0: 1
1: 0
2: 1
3: 40
4: 455
1150336472_1150336481 -6 Left 1150336472 17:64334221-64334243 CCCCCGGGCCAGCGCCCAGCTCT 0: 1
1: 0
2: 8
3: 24
4: 264
Right 1150336481 17:64334238-64334260 AGCTCTCTCTCCTCGGCCCTGGG 0: 1
1: 0
2: 4
3: 25
4: 422
1150336472_1150336480 -7 Left 1150336472 17:64334221-64334243 CCCCCGGGCCAGCGCCCAGCTCT 0: 1
1: 0
2: 8
3: 24
4: 264
Right 1150336480 17:64334237-64334259 CAGCTCTCTCTCCTCGGCCCTGG 0: 1
1: 0
2: 1
3: 51
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150336472 Original CRISPR AGAGCTGGGCGCTGGCCCGG GGG (reversed) Intronic
900550020 1:3250033-3250055 AGCGCTGGGCCGTGGCCCTGGGG + Intronic
901056650 1:6451469-6451491 AGAGCTGCCCGCTGGCCCGGAGG + Intronic
902081015 1:13820727-13820749 GGAGCTGGGGGCTGGACCTGAGG - Intronic
902477716 1:16697036-16697058 AGAGCTGCCCGCTGGCCCCGAGG - Intergenic
903029921 1:20456618-20456640 AAAGCAGGGTGCTGGCCCCGAGG + Intergenic
903686402 1:25135396-25135418 AGAGCTGGGGGAGGGTCCGGGGG + Intergenic
903750865 1:25619505-25619527 AGAGGTGGGCGCTGGAAGGGAGG - Intronic
905362678 1:37431243-37431265 GGAGCTGTGCCCTGGCCAGGTGG + Intergenic
906140476 1:43531176-43531198 GGAGCTGGGGGCGGTCCCGGGGG + Intronic
912449505 1:109760506-109760528 AGAGCTGGGCCCTGGGCAGGGGG - Intronic
914231751 1:145768236-145768258 AGGGGTGGGCGCTGGCCTGGAGG - Intronic
914916561 1:151822729-151822751 AGACCTTGGCTCTGGCCCTGAGG + Intronic
917660069 1:177169776-177169798 AGAGCTGGGGGCTGGAGCTGGGG - Intergenic
917971552 1:180211295-180211317 AGAGCAGGGGGCTTGCCAGGAGG + Intergenic
921338001 1:214107632-214107654 AGGGCTGGGCACTGGCCCCTGGG - Intergenic
921384054 1:214551768-214551790 AGCGCTGGGCGCGCGGCCGGGGG + Intronic
922581124 1:226698738-226698760 AGAGCTGAGCTCTAGCCCAGTGG - Intronic
922804754 1:228379487-228379509 AGACCTGGGAGCTGGCAGGGAGG + Intergenic
923755237 1:236785731-236785753 ACAGCTGGGTGCTGGCCTGCAGG + Intergenic
1063273754 10:4541017-4541039 CCAGCTGGGAGCTGGCACGGTGG - Intergenic
1063548369 10:7004007-7004029 AGAGCTGGAGGCTGGCACTGAGG + Intergenic
1063548376 10:7004108-7004130 AGAGCTGGAGGCTGGCACTGAGG + Intergenic
1065271222 10:24035912-24035934 ATAGCTGGGGGCTGGCTCTGAGG - Intronic
1065815531 10:29479471-29479493 AGAGCCGGGCTGTGGCCCAGAGG - Intronic
1065957406 10:30705750-30705772 AGAGCCGGGCTGTGGCCCAGAGG + Intergenic
1067288331 10:44923706-44923728 AGAGGTGTGGGCTGGCCAGGAGG - Intronic
1072622255 10:97087777-97087799 AGAGCTGGGCGCTGGGGGGATGG + Intronic
1075212554 10:120503285-120503307 AGAGCTGGGAGGTGGCCTGATGG + Intronic
1075715665 10:124553826-124553848 AGAGGAGGGGCCTGGCCCGGGGG - Intronic
1076370991 10:129953617-129953639 AGCGCTGGGAGCGGGCTCGGCGG - Intronic
1076485140 10:130811024-130811046 AGAGCTGGGCGTTGGCGGGTGGG - Intergenic
1076924695 10:133476423-133476445 AGAGCTGGAGTCTGGCCTGGTGG + Intergenic
1077093961 11:791603-791625 AGAGCTGGTCTCTGGGCTGGGGG - Exonic
1077140017 11:1020172-1020194 AGAGCTGGGTGAGGGTCCGGTGG + Exonic
1078377406 11:10808060-10808082 AGAGCTGGGCGCCGGGCTGGCGG - Intronic
1079064379 11:17276739-17276761 AGAGCGGAGCGGTGGGCCGGGGG + Intronic
1085052466 11:73386897-73386919 AGAGCTGGGGGCTGGGCTGTTGG + Intronic
1086184694 11:83999223-83999245 TGGGCTGGGCCCTGGCCCAGAGG - Intronic
1088921171 11:114260665-114260687 AGAGCTGGGCCCTGGCCTTGGGG + Intronic
1089535135 11:119156413-119156435 AGAGCTTGGCACTGGGCTGGTGG - Exonic
1090412005 11:126515713-126515735 ACAGCTGGGGGCTGGCCTCGGGG + Intronic
1090662186 11:128890542-128890564 AGAGCCGGGAGGTGGCGCGGAGG + Intergenic
1091369344 11:135045700-135045722 ATAGCTGGAGGCTGGCCTGGAGG - Intergenic
1091906697 12:4194991-4195013 AGAGGTGAGGGCTGGCGCGGTGG + Intergenic
1095478337 12:42608905-42608927 ACAGCTGGGCCCTGGCCTGTGGG + Intergenic
1095745637 12:45655365-45655387 AGAGCTGAGCGCTGTCCAGAAGG + Intergenic
1096122010 12:49094429-49094451 AGAGCTGCGGGCCGGGCCGGGGG - Exonic
1096494716 12:52033269-52033291 AGAGATGGGATCTGGCCCGGCGG - Intronic
1097907190 12:64932255-64932277 GGAGCTGGGCACTGGCCTTGTGG - Intergenic
1101252544 12:102950413-102950435 AAACCTGGACGCTGGCCCCGAGG - Intronic
1102197115 12:111033884-111033906 GGAGCTCGGCGCCCGCCCGGGGG - Intergenic
1104729019 12:131094892-131094914 GGAGCTGGGAGCTCACCCGGGGG + Intronic
1104789547 12:131473086-131473108 AGGGATGGGGGCTGGCCAGGGGG + Intergenic
1104822220 12:131683756-131683778 TGAGCTGGGCCCAGGCCTGGGGG + Intergenic
1104846330 12:131849022-131849044 AGAGCCGGGCGCTGCCGGGGAGG - Intronic
1104944484 12:132409537-132409559 AGAGGTAGGGGCAGGCCCGGGGG + Intergenic
1105956364 13:25287114-25287136 GGGGCTGGGAGCCGGCCCGGCGG - Intronic
1106413137 13:29524809-29524831 ACAGCTGGGCACTGGCCCACGGG + Intronic
1111950376 13:94704843-94704865 AGAGAGGGGCAGTGGCCCGGAGG + Intergenic
1113579846 13:111421119-111421141 ACAGCTGGCCCCTGGCCTGGGGG + Intergenic
1113614425 13:111670758-111670780 AAAGCTGGGGACAGGCCCGGGGG + Intronic
1113619893 13:111755672-111755694 AAAGCTGGGGACAGGCCCGGGGG + Intergenic
1114493525 14:23117849-23117871 AGAGGTGAGGGCTGGCCAGGAGG + Intronic
1122700039 14:103582137-103582159 AGCGCTGGGCTCTGGCTCAGGGG - Intronic
1122947876 14:105021369-105021391 AGACCTGGGAGCTGGCGGGGCGG - Intergenic
1202904551 14_GL000194v1_random:60663-60685 AGAGCTGGGCTCTGGCCCAGAGG - Intergenic
1123983456 15:25623818-25623840 AGAGCTGGGTGGAGGCCAGGGGG - Intergenic
1124696882 15:31870767-31870789 AGAGGAGGGCGCGCGCCCGGAGG - Intronic
1124856993 15:33398808-33398830 AGAGCGAGGCTCTGGCCTGGAGG + Intronic
1125885962 15:43229704-43229726 AGAGCTGGGAGCTGGCTGTGTGG - Intergenic
1127269501 15:57387898-57387920 AGAGATGGGGGCTGGGCAGGGGG + Intronic
1127615138 15:60677168-60677190 TGAGCTCGTCCCTGGCCCGGAGG - Intronic
1128944571 15:71811871-71811893 TGAGGCGGGGGCTGGCCCGGGGG + Intronic
1129082519 15:73052809-73052831 AGCGGCGGGCGCGGGCCCGGGGG + Intronic
1129906330 15:79190266-79190288 AGAGCAGGGGGCTGCCCCAGAGG + Intergenic
1131065196 15:89430184-89430206 AGAGCTGGGCATTGGTCCTGGGG - Intergenic
1132499815 16:280358-280380 AGAGCCGGGCACGGGCCGGGCGG + Intronic
1132583124 16:694322-694344 AGAGCTCGGGGGTGGCCCCGGGG + Exonic
1132747856 16:1444392-1444414 AGAGCTGGGCACAGGCCAGGGGG + Exonic
1133031860 16:3014820-3014842 ATAGCTGGGACCTGGCCCTGGGG + Exonic
1133305378 16:4804990-4805012 TGAGCTGGGCACTGGCCCCCCGG - Exonic
1133777176 16:8905935-8905957 GGAGCTCGGTGCTGGCCCTGTGG + Intronic
1136922977 16:34346635-34346657 AGAGCTGGGCCCAGGCCCTGAGG + Intergenic
1136981596 16:35065171-35065193 AGAGCTGGGCCCAGGCCCTGAGG - Intergenic
1139558836 16:67729121-67729143 AGAGCTGATGTCTGGCCCGGTGG + Intronic
1141650566 16:85390714-85390736 AGAGCTGGGCGGTGGCGGGGAGG - Intergenic
1142141046 16:88473017-88473039 AGGTCTGGGCGCAGGCCCTGCGG + Intronic
1142224154 16:88869518-88869540 AGATGTGGGCGCTGCCCCTGAGG - Intergenic
1142854437 17:2721998-2722020 AGAGCTGGGGGGAGGCCAGGCGG + Intergenic
1142866640 17:2795373-2795395 AGAGATGAGCACTGGCCCTGTGG + Intronic
1143520244 17:7440503-7440525 AGAGATGGGCGCCGACTCGGGGG + Intronic
1143568529 17:7740049-7740071 GGATCAGGGCGGTGGCCCGGGGG + Intronic
1144634930 17:16899580-16899602 AGAGCTGGGGCCGGGCGCGGTGG - Intergenic
1144752316 17:17657733-17657755 AGAGGTTGGCACTGGCCAGGTGG - Intergenic
1144955197 17:19015541-19015563 AGTCCTGAGTGCTGGCCCGGGGG - Intronic
1145903316 17:28501750-28501772 TGAGCTGGGCTCTGGCCTGGAGG - Intronic
1148158303 17:45435980-45436002 TGAGCAGGGCTCTGGCCCTGAGG - Exonic
1148480501 17:47956939-47956961 AGGGCTGGGCCCTTGCCCTGGGG + Intronic
1150132825 17:62678535-62678557 AGAGCTGGGTCCAGGCCCAGGGG + Exonic
1150336472 17:64334221-64334243 AGAGCTGGGCGCTGGCCCGGGGG - Intronic
1152740484 17:82016382-82016404 GGAGCTGGGGCCTGGCCCTGGGG + Intronic
1152810225 17:82378337-82378359 AGAGCTGGTCCCTGGCTTGGTGG + Intergenic
1155507458 18:26547702-26547724 GGAGCAGGGCGCCGGGCCGGTGG - Intronic
1157257716 18:46153330-46153352 AGAGCTGAGAGCTGGCTGGGAGG + Intergenic
1159045486 18:63366143-63366165 AGTGCTGGGCGCAGGCAAGGAGG + Intronic
1159931471 18:74316393-74316415 AGGGGTGGGCGCTCGCCTGGGGG + Intronic
1160100502 18:75916249-75916271 GGCGCTGGACGCGGGCCCGGCGG - Intergenic
1160505179 18:79422917-79422939 AGGGCTGGGGGCTGCCTCGGGGG + Intronic
1160533006 18:79576572-79576594 TGAGCTGGAAGCTGGCCGGGAGG + Intergenic
1160794912 19:940843-940865 TGAGGCGGGCGCTGCCCCGGTGG - Intronic
1160837383 19:1131315-1131337 AGAACTGGGGGCTGGCGGGGAGG - Intronic
1160874253 19:1289954-1289976 AGAGCCGGGCGGTGGGCCTGGGG + Intronic
1161046674 19:2138586-2138608 AGTGCTGGGCGCTGGCCACTGGG + Intronic
1161513004 19:4682290-4682312 TGAGCTGGTCCCTGGCCCTGTGG + Intronic
1161925066 19:7293924-7293946 AGCGCGCGGCGCTGGCCCGCGGG + Exonic
1162020669 19:7867046-7867068 AGAAATGGGCTCTGGCCTGGAGG - Intergenic
1162515854 19:11147236-11147258 AGAGCTGGGTGCTGTCCAGGTGG + Exonic
1162925835 19:13930156-13930178 TGAGCTGGTCGCGGGCCGGGTGG + Intronic
1163241701 19:16067604-16067626 ATGGCTGGGCGCTGGCGTGGGGG - Exonic
1163702835 19:18794998-18795020 GGAGCTGGGCGCTGGGCTGAAGG - Intergenic
1166197670 19:41217717-41217739 GGAGCTGGGAGCTTGCCCTGAGG + Intergenic
1166784468 19:45359375-45359397 AGATCTGGGCCCTTGCCCTGGGG - Intronic
1167096584 19:47377811-47377833 AGAGGAGGGTGCTGCCCCGGTGG + Intronic
1167463547 19:49638671-49638693 AGAACTGGGAGCCAGCCCGGAGG + Intronic
1167679330 19:50909650-50909672 AGGGCTGGGGGCGGGCCCAGGGG + Intronic
1167721700 19:51184277-51184299 AGAGCTGGACGCTGTCCCCAAGG - Intergenic
1202711732 1_KI270714v1_random:22862-22884 AGAGCTGCCCGCTGGCCCCGAGG - Intergenic
925160355 2:1678923-1678945 AGAACTGAGCGCCGGCCTGGTGG - Intronic
926222050 2:10942708-10942730 AGAGGTGGCTGCTGGGCCGGTGG + Intergenic
928101030 2:28437471-28437493 AGAGCTGGGCGCTGGCCCTCGGG - Intergenic
928169462 2:28994118-28994140 AGAGCTGAGGGCTGACCCAGAGG + Intronic
928323186 2:30300150-30300172 AGAGCTGGGCTGGGGCCGGGAGG - Intronic
929455410 2:42061522-42061544 AGAGGTGGGTGATGGCCCAGAGG + Intergenic
932569936 2:72933286-72933308 AGAGCATGGGGCTGGCCCGTGGG + Intronic
933809789 2:86026119-86026141 AGAGCTAGCTGCTGGCCCTGTGG - Exonic
934502086 2:94869732-94869754 AGAGCTGGGCTCTGGCCCAGAGG + Intergenic
935309177 2:101766268-101766290 AGTGCTGGGGGCTGGACAGGAGG + Intronic
935590433 2:104842828-104842850 AGCGCTGGTCGCTGCCCCTGTGG + Intergenic
937212259 2:120282189-120282211 AGAGCTGGGGCCGGGCGCGGTGG + Intronic
937249231 2:120512714-120512736 AGAGCTAGGGGCTTGCCAGGAGG - Intergenic
938451525 2:131425228-131425250 GGAGGCGGGCGCTGGCTCGGGGG + Intergenic
939189707 2:138902033-138902055 AGAGCTGTGCCCAGGCCCTGCGG - Intergenic
941111749 2:161424142-161424164 AGAGCGAGGTGCTGGCCCAGCGG + Exonic
945446298 2:209942061-209942083 AGTACTGGTCCCTGGCCCGGAGG - Intronic
948126315 2:235567159-235567181 AGGGCTGCCCGCTGGCCTGGGGG - Intronic
948359986 2:237413134-237413156 AGGGCTGTTCTCTGGCCCGGAGG - Intronic
948696686 2:239736427-239736449 AGAGCAGGGCTCAGGCCCAGGGG - Intergenic
1169130609 20:3164754-3164776 AGAGCGGGACGCGGGCCCTGCGG - Exonic
1169145294 20:3248500-3248522 AGATGTGGAAGCTGGCCCGGGGG - Intergenic
1170549979 20:17468445-17468467 ACAGCAGGACGCTGGCCCGTGGG - Intronic
1170549990 20:17468499-17468521 ACAGCAGGACGCTGGCCCGTGGG - Intronic
1170718368 20:18851914-18851936 AGAGCTGTGAGCTGGCCTGCAGG + Intergenic
1171026187 20:21632614-21632636 TGAGCTGGGCCTTGGCCAGGAGG + Intergenic
1171446783 20:25210140-25210162 AGAAGTGAGCGCTGGCACGGTGG - Intronic
1171972528 20:31573168-31573190 GGAGCCAGGCGCCGGCCCGGGGG - Intronic
1172042694 20:32057145-32057167 GGAGCTGGGGGCTGCCCTGGGGG + Intronic
1172586960 20:36092200-36092222 CGAGCTGGGCGCGGGGCCGCGGG + Intronic
1172954792 20:38748529-38748551 AGTGCTGGAGGCCGGCCCGGTGG + Exonic
1173165184 20:40682892-40682914 AGTGCTGCGCGGTGGCTCGGGGG + Intergenic
1173843983 20:46176703-46176725 AGAGCTGGGGACAGGCCCGGAGG + Intronic
1175831102 20:61965891-61965913 AGGGCTGGGGGCGGGGCCGGGGG - Intronic
1175887248 20:62299194-62299216 GGCTCTGGGCGCTGACCCGGTGG + Intergenic
1176162320 20:63653980-63654002 AGGGGTGGGCGCTGGCCTGGAGG + Intergenic
1176244126 20:64089349-64089371 AGAGCTGGGAGCTGCCTTGGTGG + Intronic
1176623921 21:9075430-9075452 AGAGCTGGGCTCTGGCCCAGAGG - Intergenic
1179026587 21:37683752-37683774 AGAGCTGGGGTCTGGACCTGGGG + Intronic
1179258356 21:39737316-39737338 AGAGCTGAGTGCTTGCTCGGTGG - Intergenic
1179572249 21:42284644-42284666 AGAGTTTGGCGCTGGGCTGGTGG - Exonic
1179584324 21:42365264-42365286 AGAGCTGGGGGCTGGGGTGGGGG + Intronic
1179710409 21:43210001-43210023 ACAGCCGGGTGCTGGCCCAGGGG - Intergenic
1179831591 21:44000450-44000472 AGAGGTGGGAGCTGGGCCAGGGG + Intergenic
1181266003 22:21631256-21631278 AGGCCTGGGTGCTGGCCCCGAGG - Intergenic
1181307578 22:21925679-21925701 AGAGTTGGGGGCAGGGCCGGGGG + Intronic
1181602540 22:23960954-23960976 AGAGCAGGGCGGGGGCCTGGGGG + Intronic
1181605974 22:23980353-23980375 AGAGCAGGGCGGGGGCCTGGGGG - Intronic
1182319489 22:29469458-29469480 AGTGCTGGGTGCTGGCCCAAGGG - Intergenic
1183219962 22:36506299-36506321 CGTGCTGGGCGCTGGGCCCGCGG - Exonic
1183815720 22:40298677-40298699 AGAGCTGGGGCCGGGCGCGGTGG + Intronic
1185258474 22:49849205-49849227 AGACCTGGGCGCTGTTCTGGGGG + Intergenic
949918820 3:8985662-8985684 GGAGCTGGGCGCCAGCCAGGCGG + Exonic
950259945 3:11536396-11536418 GGAACAGGGCGCTGGCCAGGTGG - Intronic
950434014 3:12967763-12967785 CGAGCTGGGGGCGGGGCCGGAGG + Intronic
952788210 3:37176464-37176486 CGAGCTGAGCCCTGGGCCGGCGG + Intronic
952932465 3:38370896-38370918 AGATCTGGGTGCTGCCCCTGGGG + Intronic
953385257 3:42502580-42502602 AGGGCTGGGGGCGGGCCCCGGGG - Intronic
953476859 3:43212542-43212564 AGAGCTGGGCCCTGGCACAGTGG + Intergenic
954381633 3:50221936-50221958 AGAGCTGGTCACTGGCCTAGAGG + Intergenic
956462352 3:69485060-69485082 ACAGCTGGGAGCTGGCCTGCAGG - Intronic
956659406 3:71583341-71583363 AGAGCTGGGCCTCGACCCGGGGG + Intronic
956695880 3:71919103-71919125 AGAGCTGGGCTCTGTCCTGAGGG - Intergenic
957133738 3:76257038-76257060 AGAGGTGGGGGCTGGGCCGAGGG - Intronic
961353798 3:126321344-126321366 AGAGCATGGCTCTGGCCCTGGGG - Intergenic
961562432 3:127740007-127740029 AGAGCTGCCTGCTGGCCCGCAGG - Intronic
961653785 3:128430369-128430391 AGAGCTGGGCACTGGAGTGGGGG + Intergenic
961754791 3:129121462-129121484 AGGGCCGGGCCCAGGCCCGGGGG - Exonic
962849170 3:139295100-139295122 AGCGCTGAGCCCTGGCCCAGAGG + Intronic
963906725 3:150779230-150779252 TGAGCTTGGCGCTGCCCCGCTGG + Intergenic
964093905 3:152909361-152909383 AGAGCTGGGTGCTGGCTCAGTGG - Intergenic
968108392 3:196020567-196020589 TGAGGTGGGTGCTGGCCCCGGGG - Intergenic
968434055 4:576026-576048 AGAGCGCGGCGCAGGCCCCGCGG + Intergenic
968506699 4:974153-974175 AGAGCTGGGCGCTCGGCGTGAGG - Intronic
968534376 4:1113889-1113911 AGGGCCGGGAGCTGGGCCGGAGG + Intergenic
968640391 4:1711855-1711877 AGAGGTGGGCGCGGGACCCGGGG - Exonic
969174313 4:5387074-5387096 AGAGCTGGGCGGTGGCCCCTGGG + Intronic
969350310 4:6594477-6594499 GGAGCAGGGCGCTCGCCCAGTGG - Intronic
969402130 4:6962643-6962665 AGAGCTGGGGGGTGGCCAGTAGG - Intronic
969624547 4:8295626-8295648 AGGCCTGGGCGTTGGCCAGGAGG - Intronic
973248143 4:48032302-48032324 AGAGCTGGGCTCTGGTACTGGGG - Intronic
975166948 4:71187460-71187482 GGAGGCGGGCGCGGGCCCGGGGG + Intronic
980053956 4:128062077-128062099 AGAGGTGGCAGCTGGCCCTGCGG + Intronic
984966361 4:185143503-185143525 AGAGGCGGGCGCGGGCGCGGCGG + Intronic
985542512 5:493493-493515 AGGGCCGGGTGCTGGCCCAGAGG + Intronic
985731653 5:1552972-1552994 CCCGCTGGACGCTGGCCCGGCGG + Intergenic
986658772 5:10040754-10040776 AGAGCAGAGCCCTGGCCTGGAGG + Intergenic
987303487 5:16617196-16617218 GGAGCTGGGCGGTGTCCCCGGGG + Intergenic
994310151 5:98259849-98259871 AGAGCTGGGCTCAGAACCGGTGG - Intergenic
996234422 5:121108607-121108629 AGAGCTGAGCAGAGGCCCGGCGG - Intergenic
996559035 5:124808882-124808904 TGTGCAGGGCGCTGGCCCTGCGG + Intergenic
997013766 5:129906241-129906263 GGAGCAGCGCGCTGGCACGGTGG - Intronic
999240215 5:150123079-150123101 AGAGCTCCGCGCTGGGCGGGCGG + Exonic
1001405525 5:171474434-171474456 AGAACTGGGCGCGGGCCAGAGGG + Intergenic
1001442839 5:171758654-171758676 AGGGCTGGGGGCTTGCCAGGTGG + Intergenic
1001743793 5:174074490-174074512 AGAGCTGGGAGCTGGCACAGTGG - Intronic
1002200138 5:177523539-177523561 AGGGGTGGGGGCTGGCCAGGAGG - Intronic
1002303821 5:178272182-178272204 AGAGCAGGAGGCTGTCCCGGGGG - Intronic
1002898734 6:1393625-1393647 AGAGCAGGGCCCGAGCCCGGCGG + Intronic
1003869672 6:10391435-10391457 AGAGCTGAGCTCTGGCGCTGGGG + Intergenic
1005303791 6:24495097-24495119 CGGGCCGGGCGCAGGCCCGGAGG - Exonic
1005674098 6:28136776-28136798 TGAGCTGGGCCCTGGGCCAGAGG - Intergenic
1006185575 6:32179896-32179918 GGAGCTGGTCTCTGGCCCTGGGG - Exonic
1006321636 6:33322775-33322797 AGAGCTGGGCGCTGAGTCTGAGG - Intronic
1007654260 6:43442777-43442799 AAAGCTGAGTGCTGGCCCTGGGG + Intronic
1016466916 6:144334792-144334814 ATAGCTGGGAGCTGGCCCTGAGG + Intronic
1016786618 6:148017604-148017626 AGAGCTGAGCGCTTACCCTGGGG + Intergenic
1019351030 7:554047-554069 AGAGCTGGGAGCTGTTCCTGTGG - Intronic
1019407846 7:893181-893203 AGTGTTGGGCGCGGGCGCGGTGG + Intronic
1019407860 7:893251-893273 AGTGTTGGGCGCGGGCGCGGTGG + Intronic
1019407867 7:893286-893308 AGTGTTGGGCGCGGGCGCGGTGG + Intronic
1019407900 7:893452-893474 AGTGTTGGGCGCGGGCGCGGTGG + Intronic
1019407938 7:893653-893675 AGTGTTGGGCGCAGGCGCGGTGG + Intronic
1019563320 7:1668316-1668338 TGTGCTGGGCGCCTGCCCGGAGG - Intergenic
1019641716 7:2106901-2106923 AGACCTGGGCAGGGGCCCGGGGG + Intronic
1019776921 7:2917325-2917347 AGAGACGGGGGCTGACCCGGGGG + Exonic
1019825973 7:3284746-3284768 AGAGCTGGGCCCGGGTGCGGTGG + Intergenic
1019915030 7:4127751-4127773 AGAGTCAGGCGCAGGCCCGGAGG - Intronic
1020649209 7:10854863-10854885 ACAGCTGGGTGCTGGCCTGCAGG + Intergenic
1022923239 7:35037137-35037159 TGCGCTGGGCGCTGGGCCTGCGG - Intronic
1023834067 7:44058288-44058310 AGAGGTGGAGGCTGGCCTGGGGG + Intronic
1023837245 7:44075495-44075517 TGAACTGGGCAGTGGCCCGGGGG + Intronic
1027267283 7:76501369-76501391 AGAGCTGAGCGCTGGGCAGGCGG - Intronic
1027319094 7:77001234-77001256 AGAGCTGAGCGCTGGGCAGGCGG - Intergenic
1029115908 7:98236948-98236970 GAATCTGGGCGCAGGCCCGGGGG + Intronic
1029213361 7:98927290-98927312 AGGGCAGGGCGCTGGGCCGCAGG - Exonic
1029476506 7:100788140-100788162 AGAGCTGGGCCAGGGCCTGGTGG + Intronic
1033476955 7:141701461-141701483 AGCTCAGGGCGCTCGCCCGGGGG + Intronic
1034197976 7:149262485-149262507 CGGGCTGGGCGATGGGCCGGGGG - Intronic
1034311806 7:150095051-150095073 ACAGCAGGGAGCTGGCCCAGAGG - Intergenic
1034530959 7:151696298-151696320 GGAGCTGGGAGCTGCCCAGGCGG - Intronic
1034795048 7:154005603-154005625 ACAGCAGGGAGCTGGCCCAGAGG + Intronic
1034800712 7:154053676-154053698 AGAGCTGGGCCCTGGGACAGAGG - Intronic
1035108002 7:156458185-156458207 AGAGCTTGGCCCTGGACTGGCGG - Intergenic
1035185866 7:157125505-157125527 AGAGCTGAGCGCCGGCCCCAGGG + Intergenic
1035587429 8:786622-786644 AGAGACGGGCGCTGCCTCGGTGG + Intergenic
1036750959 8:11443581-11443603 TGTGCTGGGCGCTGGCCGGGTGG - Intronic
1039270359 8:35874026-35874048 AAAGCTTGGCGGTGGCCAGGTGG - Intergenic
1039382573 8:37099881-37099903 AGAGCTGAGCCCTGGCTTGGAGG + Intergenic
1039572803 8:38600890-38600912 GGAGCTGGTCTCTGGCCCTGGGG + Intergenic
1039873691 8:41567679-41567701 AGAACTGGACGGTGGCCCGCGGG - Intergenic
1040594235 8:48822156-48822178 AGAGCTGGCTGCTGGACCTGAGG + Intergenic
1042858891 8:73294469-73294491 CGGGCTGGGGGCTGGGCCGGGGG + Intronic
1045674201 8:104589477-104589499 AGGGCTGGGCTCTGGCCCAGCGG + Intergenic
1048973550 8:139658375-139658397 AGAGCTGGGGGCTGGCCTCCAGG - Intronic
1049798012 8:144505341-144505363 AGAGCTGGGCGCAGTGCAGGTGG + Exonic
1049821365 8:144635662-144635684 GGAGCTGAGCGCTTACCCGGTGG + Intergenic
1050702436 9:8355760-8355782 AGACCTGGGCTCTGTCCCAGAGG + Intronic
1053138616 9:35667602-35667624 AGAGCTGGGCGCTGGCAGCAAGG + Intronic
1055611752 9:78031479-78031501 GGAGGCGGGCGCTGGCTCGGGGG + Intergenic
1055874378 9:80924557-80924579 AGAGCTGGGCAAAGGCCCTGAGG + Intergenic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1060794932 9:126507087-126507109 AGAGCTTGGGGCTTGCCCTGAGG - Intergenic
1060810924 9:126611223-126611245 AGATAGGGGCGCTGGCTCGGTGG - Intergenic
1061883000 9:133577344-133577366 AGAGGTGTGGGCGGGCCCGGGGG + Intergenic
1062165227 9:135104302-135104324 AGGGCGGGGCTCTGGCCAGGCGG + Intronic
1062243655 9:135552543-135552565 CGAGGTGGGAGCTGGCCCAGAGG + Intergenic
1062279414 9:135745314-135745336 GGAGCTGGGCGTGGGCTCGGTGG - Intronic
1062607195 9:137353604-137353626 TGGGCTGGGCGCTGCCACGGTGG - Intronic
1203747106 Un_GL000218v1:45858-45880 AGAGCTGGGCTCTGGCCCAGAGG - Intergenic
1203563002 Un_KI270744v1:73622-73644 AGAGCTGGGCTCTGGCCCAGAGG + Intergenic
1188811395 X:34657263-34657285 AGAGCGCGGCGCGGGGCCGGCGG - Exonic
1189374443 X:40455727-40455749 AGAGCTGGAGGTTGGCCTGGTGG - Intergenic
1190252355 X:48736818-48736840 GGAGATGGGGGCTGGCCTGGAGG + Intergenic
1190301392 X:49059436-49059458 AGAGCTGGGCCCTGGGTTGGGGG - Intronic
1192431901 X:71118521-71118543 GGAGGTGGGGCCTGGCCCGGTGG - Intergenic
1197749860 X:129957093-129957115 AGAGCTCGGGTCTGGGCCGGGGG + Intergenic
1199672971 X:150162011-150162033 AGAGCTGGGCTCTTGCACTGGGG + Intergenic
1200073725 X:153541215-153541237 AGAGCCAGGCGCTGGCCAGACGG + Intronic
1201160425 Y:11160853-11160875 AGAGCTGGGCTCTGGCCCAGAGG - Intergenic