ID: 1150336473

View in Genome Browser
Species Human (GRCh38)
Location 17:64334222-64334244
Sequence GAGAGCTGGGCGCTGGCCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 1, 2: 4, 3: 23, 4: 310}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150336473_1150336488 12 Left 1150336473 17:64334222-64334244 CCCCGGGCCAGCGCCCAGCTCTC 0: 1
1: 1
2: 4
3: 23
4: 310
Right 1150336488 17:64334257-64334279 TGGGGCTGCTCCTTGGAGGCAGG 0: 1
1: 0
2: 7
3: 43
4: 350
1150336473_1150336481 -7 Left 1150336473 17:64334222-64334244 CCCCGGGCCAGCGCCCAGCTCTC 0: 1
1: 1
2: 4
3: 23
4: 310
Right 1150336481 17:64334238-64334260 AGCTCTCTCTCCTCGGCCCTGGG 0: 1
1: 0
2: 4
3: 25
4: 422
1150336473_1150336484 5 Left 1150336473 17:64334222-64334244 CCCCGGGCCAGCGCCCAGCTCTC 0: 1
1: 1
2: 4
3: 23
4: 310
Right 1150336484 17:64334250-64334272 TCGGCCCTGGGGCTGCTCCTTGG 0: 1
1: 0
2: 5
3: 23
4: 293
1150336473_1150336482 -6 Left 1150336473 17:64334222-64334244 CCCCGGGCCAGCGCCCAGCTCTC 0: 1
1: 1
2: 4
3: 23
4: 310
Right 1150336482 17:64334239-64334261 GCTCTCTCTCCTCGGCCCTGGGG 0: 1
1: 0
2: 1
3: 40
4: 455
1150336473_1150336485 8 Left 1150336473 17:64334222-64334244 CCCCGGGCCAGCGCCCAGCTCTC 0: 1
1: 1
2: 4
3: 23
4: 310
Right 1150336485 17:64334253-64334275 GCCCTGGGGCTGCTCCTTGGAGG 0: 1
1: 0
2: 1
3: 58
4: 397
1150336473_1150336480 -8 Left 1150336473 17:64334222-64334244 CCCCGGGCCAGCGCCCAGCTCTC 0: 1
1: 1
2: 4
3: 23
4: 310
Right 1150336480 17:64334237-64334259 CAGCTCTCTCTCCTCGGCCCTGG 0: 1
1: 0
2: 1
3: 51
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150336473 Original CRISPR GAGAGCTGGGCGCTGGCCCG GGG (reversed) Intronic
900398903 1:2464862-2464884 GAGAGCTGGCCGTGAGCCCGAGG - Intronic
900406787 1:2496288-2496310 GAGAGCTGGGCTCGGGGCCTGGG - Intronic
902698464 1:18155814-18155836 GAGGCCTGGGCGCTGACCTGGGG + Intronic
902921045 1:19666021-19666043 GGGCGCTGGGTGCTGGCGCGCGG + Exonic
903130201 1:21274205-21274227 GAGAGCTGAGAGCTGGGCCCAGG + Intronic
903448487 1:23437242-23437264 GGGAGCCCAGCGCTGGCCCGGGG - Exonic
904041701 1:27589099-27589121 CAGAGGTGGGGGCTGGCCCTGGG + Intronic
904257816 1:29267515-29267537 GAGAGCTGGGGGCTTGCTGGGGG + Intronic
904267389 1:29325657-29325679 GATAGCGGGGCCCTGGCCTGGGG + Exonic
904333593 1:29783391-29783413 GAGAGCTGGGCACTCACCCCAGG + Intergenic
904813898 1:33181512-33181534 GAGGGCTGGGCGCGGGGACGAGG + Exonic
905031203 1:34885566-34885588 GGGGGCTTGGGGCTGGCCCGGGG + Exonic
905112409 1:35605545-35605567 CAGAGGTGGGCCCTGGCCAGGGG - Intronic
905883104 1:41477143-41477165 GAGAGGTGCGCTCTGGCCCTGGG + Intergenic
907306492 1:53516054-53516076 GTGACCTGGGGGCTAGCCCGGGG + Intronic
907317940 1:53584441-53584463 GAGAGCTGGGCTCTGACAGGTGG - Intronic
909527236 1:76639377-76639399 TAGAGCTGGGGGCTGGTGCGGGG - Intergenic
912449506 1:109760507-109760529 AAGAGCTGGGCCCTGGGCAGGGG - Intronic
912576049 1:110674106-110674128 GAGAGCTCCGGGCCGGCCCGGGG - Exonic
916189762 1:162167463-162167485 GAGAGCTGGGCTCTGGACCGGGG + Intronic
916792568 1:168136883-168136905 GCGTGCTGGTGGCTGGCCCGCGG - Intronic
918239498 1:182609372-182609394 GAGAGCTGGGGGATGGCGCCTGG + Intergenic
919978893 1:202630263-202630285 AAGAGCTGGGGGCTGACCCCTGG + Intronic
920535402 1:206733723-206733745 ATGAGCTGGGCGGTGGCCCATGG - Exonic
921338002 1:214107633-214107655 CAGGGCTGGGCACTGGCCCCTGG - Intergenic
921384053 1:214551767-214551789 GAGCGCTGGGCGCGCGGCCGGGG + Intronic
922464695 1:225838967-225838989 GTGAGCAGGGAGTTGGCCCGAGG + Intronic
924172467 1:241356823-241356845 GAGGGCTGGGTGCGGGCCGGGGG + Intronic
1062840855 10:671020-671042 CAGAGCTGGGATCTGCCCCGAGG + Intronic
1066632162 10:37468262-37468284 GAAAGCAGGGCACTGGCCCCTGG + Intergenic
1067493633 10:46740526-46740548 GAGACCTGGGCGCTTTCCTGCGG - Intergenic
1069582876 10:69577357-69577379 GAGACCTGGCCCCTGGCCCCTGG + Intergenic
1070978706 10:80627390-80627412 GGGAGCTGGGCAATGGCCAGAGG - Intronic
1071652569 10:87407748-87407770 GAGACCTGGGCGCTTTCCTGCGG + Intergenic
1075410290 10:122222715-122222737 CAGAGCCGGGCACTCGCCCGGGG + Intronic
1076485141 10:130811025-130811047 GAGAGCTGGGCGTTGGCGGGTGG - Intergenic
1076537231 10:131187491-131187513 GGGAGATGGGCGCCGGCCCTGGG - Intronic
1076587757 10:131560895-131560917 GAGAGGGGGGCTCTGGCCTGGGG + Intergenic
1077116013 11:884948-884970 GAGAGCTGGGTGCTGGCCTACGG + Intronic
1077407552 11:2389385-2389407 GAGGGCTGGGCACTGCCCCTAGG + Intronic
1077535064 11:3120113-3120135 GAGGGCTGGGCGCTGTTCCTCGG + Intronic
1081771175 11:45651347-45651369 GAGAACTGGGCGCCAGCTCGTGG - Intronic
1082813966 11:57496169-57496191 GAGAGGAGGGGGCAGGCCCGTGG + Intronic
1083656893 11:64234333-64234355 GAGGGCGGGGCGCTGCCCCTTGG - Intergenic
1084165566 11:67373394-67373416 GGGAGCTGGGCTCGGGCCGGGGG - Intronic
1084272849 11:68038428-68038450 GACAGCTGGCCTCTGGCCCCAGG + Intergenic
1084379183 11:68800105-68800127 GAGAGCTGGGTGCTGGGGCTGGG + Intronic
1084934452 11:72579478-72579500 GGGAGCTGGGAGCTGGCTGGAGG - Intronic
1084972915 11:72781379-72781401 GAGAGGTAGGGGCTGGCCCCAGG + Intronic
1086968373 11:93053879-93053901 GAAAGCTGGGGGCAGCCCCGTGG - Intergenic
1088921170 11:114260664-114260686 CAGAGCTGGGCCCTGGCCTTGGG + Intronic
1089704969 11:120271492-120271514 GAGAGGTGGGCCCTGGGCTGGGG - Intronic
1090422884 11:126587902-126587924 GAGAGCTGGGCCCTGGTACAGGG + Intronic
1090736680 11:129617162-129617184 GAGAGCTGGGCTCTGCCTCCTGG - Intergenic
1091252597 11:134156153-134156175 CAGAGCTGGGCGCTGAGCCCAGG - Intronic
1092065686 12:5588057-5588079 GACAGCTGAGAGCTGGGCCGGGG + Intronic
1093894535 12:24562102-24562124 GAGAGGTGGGAGGCGGCCCGAGG - Intergenic
1094843616 12:34352033-34352055 CAGAGCTGGGGTCTTGCCCGTGG - Intergenic
1095478336 12:42608904-42608926 CACAGCTGGGCCCTGGCCTGTGG + Intergenic
1099873286 12:88374227-88374249 GAGATCTGAGCCCTGGCCCTTGG - Intergenic
1101454179 12:104812699-104812721 GACAGCTGTGCAGTGGCCCGGGG + Intronic
1102197116 12:111033885-111033907 GGGAGCTCGGCGCCCGCCCGGGG - Intergenic
1102438176 12:112941577-112941599 GAGAGCTGTGCCCCGGCCCGAGG - Exonic
1103906146 12:124328115-124328137 CAGAGCTGGGGGCTGGCTGGGGG + Intronic
1104390249 12:128385974-128385996 GAGAGCTGGGCTATGGCCCCTGG + Intronic
1104418981 12:128619622-128619644 GAGAGGTGGGTGCTGGCAGGAGG - Intronic
1104463841 12:128974880-128974902 GAGAGCTGGCCTCTGGCCAAGGG - Intronic
1104713795 12:131003906-131003928 GAGAGCTGGGGGCTGTGCTGGGG + Intronic
1104729018 12:131094891-131094913 GGGAGCTGGGAGCTCACCCGGGG + Intronic
1104822219 12:131683755-131683777 GTGAGCTGGGCCCAGGCCTGGGG + Intergenic
1104944483 12:132409536-132409558 GAGAGGTAGGGGCAGGCCCGGGG + Intergenic
1105239531 13:18597710-18597732 AAGAGCTGGGCCCTGGCTCTGGG + Intergenic
1106413136 13:29524808-29524830 CACAGCTGGGCACTGGCCCACGG + Intronic
1107935239 13:45340890-45340912 CAGAGCTGGGCGCGAGCCCCGGG + Intronic
1112501747 13:99948237-99948259 GAGGGCTGGGACCTGGCCCTGGG + Intergenic
1113579845 13:111421118-111421140 GACAGCTGGCCCCTGGCCTGGGG + Intergenic
1114672095 14:24416820-24416842 GTGAGCTGTGGGCTGGCCCTGGG + Exonic
1117684457 14:58239024-58239046 GAGAGCTGGGGGATGACACGTGG + Intronic
1118735082 14:68695347-68695369 GAGATGTGGGCTCTGGCCGGCGG - Intronic
1119474102 14:74917314-74917336 GAGAGCAGGGGGCTTGCCCGTGG + Intronic
1121154151 14:91667046-91667068 GCTAACTGGGCGCTGGCCCCTGG - Intronic
1121951400 14:98173880-98173902 GAGAGCTGTGCACTGGCTGGAGG + Intergenic
1122188181 14:100018192-100018214 GAGAGCAGTGCGCTGCCCTGTGG + Intronic
1122700040 14:103582138-103582160 GAGCGCTGGGCTCTGGCTCAGGG - Intronic
1122910666 14:104826406-104826428 GAGAGCTTGGGGCTGGCCACGGG - Intergenic
1122924066 14:104891788-104891810 GAGTGCTGGGCGGGGGCCTGAGG + Intronic
1123491715 15:20786374-20786396 AAGAGCTGGGCCCTGGCTCTGGG - Intergenic
1123548217 15:21355468-21355490 AAGAGCTGGGCCCTGGCTCTGGG - Intergenic
1127564451 15:60173144-60173166 AAGAGCTGGGCCCTGGTCCGTGG - Intergenic
1128944570 15:71811870-71811892 GTGAGGCGGGGGCTGGCCCGGGG + Intronic
1129409188 15:75339461-75339483 TAGAGCTGGGACCTGGCCCTGGG + Intronic
1129678305 15:77644022-77644044 GAGTGCCGGGCCCTGCCCCGTGG - Intronic
1129691806 15:77718002-77718024 GGGAGCTGGGAGCAGGGCCGAGG + Intronic
1202956549 15_KI270727v1_random:82698-82720 AAGAGCTGGGCCCTGGCTCTGGG - Intergenic
1132514983 16:362036-362058 GAGAGCTTGGCTCTGCCCAGTGG - Intergenic
1132676127 16:1121950-1121972 GAGAGCTGGGGACAGGCCCAGGG - Intergenic
1132722835 16:1325433-1325455 GAGAGCCTGGTCCTGGCCCGCGG - Exonic
1132747855 16:1444391-1444413 CAGAGCTGGGCACAGGCCAGGGG + Exonic
1132865206 16:2089829-2089851 CAGTGCTGGCCGCAGGCCCGGGG + Exonic
1133026543 16:2991187-2991209 GAGAGCTGGGCTCTGGAGGGAGG + Intergenic
1135329070 16:21546134-21546156 GAGAGCTGGGCGCTGGATGCAGG + Intergenic
1135329076 16:21546167-21546189 GAGAGCTGGGCGCTGGATGCAGG + Intergenic
1136110820 16:28062954-28062976 GAGCGCTGGGAGCTGGGCCCAGG + Intronic
1136339417 16:29632111-29632133 GAGAGCTGGGCGCTGGATGCAGG + Intergenic
1137620962 16:49876512-49876534 AAGAACAGGGCGCAGGCCCGAGG + Intergenic
1138583959 16:57958599-57958621 GAGACCTGGGCTCTGGCTCCTGG - Intronic
1140048852 16:71462054-71462076 GGGAGCAGGGCGGCGGCCCGGGG - Exonic
1140223153 16:73058333-73058355 GCGAGCAGGGCGCGGGCGCGGGG + Intronic
1140932320 16:79639375-79639397 CAGAGATGGGAGCTGGCCCCTGG - Intergenic
1141787276 16:86210009-86210031 GAGAGCTGGGGGCTGGGGAGAGG - Intergenic
1142045508 16:87922673-87922695 GAGAGCCGGCAGCTGGCCCAGGG - Intronic
1142219861 16:88848796-88848818 GAGGGATGGGCGCTGGGCCCCGG + Intronic
1142293017 16:89201346-89201368 GGGCGCGGGGCGCGGGCCCGGGG + Intronic
1142409536 16:89908749-89908771 GGGAGCTGGGAGCTGGCAGGTGG - Intronic
1142836860 17:2593862-2593884 GCGCGCTGGGCCCGGGCCCGGGG - Exonic
1143165286 17:4894403-4894425 GAGCGCTGGGAGCTGGACAGCGG + Intronic
1143508170 17:7381000-7381022 GGGACCTGGCCGCTGGCCCGGGG - Exonic
1143568528 17:7740048-7740070 GGGATCAGGGCGGTGGCCCGGGG + Intronic
1143785233 17:9250773-9250795 GAGAGGTGGTCGGTGGCCTGGGG + Intronic
1144205754 17:12978535-12978557 GGGAGCAGGGAGCTGGGCCGGGG - Intronic
1144626299 17:16845979-16846001 GGGAGCTGGCAGGTGGCCCGTGG - Intergenic
1144880134 17:18426741-18426763 GGGAGCTGGCAGGTGGCCCGTGG + Intergenic
1144965568 17:19075372-19075394 GAGAGCTGGGAGGTGGCCCAAGG + Intergenic
1144982399 17:19176811-19176833 GAGAGCTGGGAGGTGGCCCAAGG - Intergenic
1144985824 17:19201428-19201450 GAGAGCTGGGAGGTGGCCCAAGG + Intergenic
1145152099 17:20517643-20517665 GGGAGCTGGCAGGTGGCCCGTGG - Intergenic
1145249307 17:21288639-21288661 GAGAGCTGGGCCATGCCCAGGGG - Intronic
1146639729 17:34531144-34531166 GAGAGCTGGGATTGGGCCCGTGG - Intergenic
1147440344 17:40443705-40443727 GAGGACTGGGCGCGGGCGCGGGG - Exonic
1147938152 17:44025506-44025528 GAGAGCTGGGCTCTGGGAGGAGG - Intergenic
1148088627 17:45009421-45009443 GGAAGCTGGGCACTGGCCAGAGG - Intergenic
1148765479 17:50036250-50036272 GAGAGCTTGGGGCTGGGCAGAGG - Intergenic
1148765537 17:50036523-50036545 GAGAGCTTGGGGCTGGGCAGGGG + Intergenic
1148841675 17:50502740-50502762 GAGTTCTGGGCTCTGTCCCGTGG - Intergenic
1150336473 17:64334222-64334244 GAGAGCTGGGCGCTGGCCCGGGG - Intronic
1150423001 17:65055985-65056007 GCGAGCTGGGTGCTGCCTCGGGG - Intronic
1151327381 17:73387720-73387742 GAGAGCTGGGGGCAGGCTGGAGG + Intronic
1151875993 17:76868598-76868620 GGGACCGGGGCGCGGGCCCGGGG + Intronic
1152419013 17:80182169-80182191 GAGAGATGGGCTCTGGGCCCTGG + Intronic
1153770076 18:8408240-8408262 GTGAGCTGGGCCCTGACCAGGGG + Intergenic
1157094891 18:44679276-44679298 GGGAGCGGGGCTCTTGCCCGGGG - Intergenic
1157799867 18:50610370-50610392 GAGAACTGGGCACTGCCCAGAGG + Intronic
1159603026 18:70446555-70446577 GAGATCTGCGTGCTGGCCCCTGG - Intergenic
1159931470 18:74316392-74316414 GAGGGGTGGGCGCTCGCCTGGGG + Intronic
1159955695 18:74516867-74516889 TAGAGCCAGGCGCTGACCCGGGG - Intronic
1160505178 18:79422916-79422938 GAGGGCTGGGGGCTGCCTCGGGG + Intronic
1160535012 18:79587003-79587025 GAGACCTGGGGGGTGGCCAGCGG + Intergenic
1160874252 19:1289953-1289975 GAGAGCCGGGCGGTGGGCCTGGG + Intronic
1160989101 19:1853368-1853390 AAGAGGTGGGTCCTGGCCCGTGG - Exonic
1161046673 19:2138585-2138607 CAGTGCTGGGCGCTGGCCACTGG + Intronic
1161048773 19:2151175-2151197 CAGGGCTGGGCCCTGGGCCGGGG + Intronic
1161323871 19:3653685-3653707 GAGAGAGGGGGGCTGGCCAGGGG - Intronic
1161456926 19:4374300-4374322 CAGAGCTGGCCCCTGGCCCCTGG - Intronic
1161925065 19:7293923-7293945 GAGCGCGCGGCGCTGGCCCGCGG + Exonic
1162535640 19:11261853-11261875 GACAGCTGGGCACTGGACCCTGG + Intronic
1162776967 19:12985771-12985793 GAGAGCTGGGTGCTGGAGTGAGG + Intergenic
1163462646 19:17448289-17448311 AGGAGCTGGGCGCCGGCCCCGGG - Exonic
1164525524 19:29010504-29010526 GAGTGGGAGGCGCTGGCCCGTGG + Intergenic
1165351204 19:35276981-35277003 GAGAGCTGGGCGCCGGCTGCAGG - Intronic
1165406389 19:35633706-35633728 GAGAGCTGGGCCTAGGCCTGGGG + Exonic
1165706250 19:37978263-37978285 GACAGTTGGGCGATGGGCCGTGG + Intronic
1166784469 19:45359376-45359398 GAGATCTGGGCCCTTGCCCTGGG - Intronic
1166835401 19:45664508-45664530 GAGAGCTGGGAGCTGGGACTGGG + Intergenic
1168297344 19:55383855-55383877 GGGCGCGGGGCGCTGGCCCGCGG + Exonic
1168298309 19:55388693-55388715 GAGGGCTGGGCCCTGGGCCCTGG + Intronic
925362768 2:3290979-3291001 GAAAACTGAGGGCTGGCCCGTGG - Intronic
926077371 2:9951919-9951941 GCGAGCCGGGCGCAGACCCGAGG + Intronic
926737144 2:16082250-16082272 GAGAGCTGGTCACTGGGCTGGGG + Intergenic
927721319 2:25384468-25384490 GAGAGCAGGGTGCTGGGCCCTGG + Intronic
928101031 2:28437472-28437494 AAGAGCTGGGCGCTGGCCCTCGG - Intergenic
928174145 2:29022858-29022880 CAGAGCTGAGGGCTGGCCAGAGG + Intronic
931563336 2:63588179-63588201 GACAGGTGAGCCCTGGCCCGAGG - Exonic
932569935 2:72933285-72933307 AAGAGCATGGGGCTGGCCCGTGG + Intronic
933858479 2:86441570-86441592 GGGAGCTGGGCGCCGGGGCGGGG + Intronic
934215600 2:90028625-90028647 GACTGCTGGGCTCTGGCCCTGGG - Intergenic
938451524 2:131425227-131425249 GGGAGGCGGGCGCTGGCTCGGGG + Intergenic
938482169 2:131671783-131671805 AAGAGCTGGGCCCTGGCTCTGGG + Intergenic
940646791 2:156400322-156400344 GAGCGCTGGGCCCGGGCTCGAGG + Intergenic
942314095 2:174682592-174682614 GAGCGGTGGGCGCGGGCGCGCGG - Intronic
942314219 2:174682992-174683014 GAGGGCAGGGCGCGGGCCGGCGG - Intergenic
945234442 2:207621834-207621856 TGGAGCTGGGTGCTGGCACGGGG - Exonic
948054826 2:235003279-235003301 GAGAGCTAGGCCCTGGCCAGGGG - Intronic
948415326 2:237798803-237798825 GAGAGCGGGGCGCTGGCCCGTGG + Exonic
948696687 2:239736428-239736450 GAGAGCAGGGCTCAGGCCCAGGG - Intergenic
948702383 2:239768475-239768497 GAGAGGTGGGCAGTGGCCCTGGG - Intronic
949027766 2:241774397-241774419 GTGGGCTGGGCGCTGGCAGGAGG - Intergenic
1170451808 20:16490889-16490911 GAGTGCTAGGAGCTGGCTCGCGG + Intronic
1170549980 20:17468446-17468468 TACAGCAGGACGCTGGCCCGTGG - Intronic
1170549991 20:17468500-17468522 TACAGCAGGACGCTGGCCCGTGG - Intronic
1172293739 20:33793426-33793448 TGGAGCTGGGCCTTGGCCCGGGG + Intergenic
1172586959 20:36092199-36092221 GCGAGCTGGGCGCGGGGCCGCGG + Intronic
1172765060 20:37346561-37346583 GCGAGCTGGGCCCTAGCCCCCGG + Intronic
1175278671 20:57788335-57788357 GAGAGCTGGGCACTGGGAGGTGG - Intergenic
1175307351 20:57985479-57985501 GTCAGCTGGTCGCTGGCCCCAGG - Intergenic
1175394514 20:58649697-58649719 GAGAGCAGGGCGCTCGCCCGGGG - Intergenic
1175831103 20:61965892-61965914 GAGGGCTGGGGGCGGGGCCGGGG - Intronic
1175865837 20:62175965-62175987 GTGTGCTGGGCGCTGGTCAGCGG + Intronic
1175915537 20:62424120-62424142 GAGAGCTGAGCTCTGGTCCAGGG + Intronic
1175920023 20:62446330-62446352 GAGGGCAGGGCGGGGGCCCGGGG + Intergenic
1176015514 20:62929283-62929305 GAGACCTGGACGCTGCCCGGTGG - Intronic
1176107595 20:63396684-63396706 GAGGCCTGGGCGCTGGGCCGGGG - Intergenic
1176144098 20:63557826-63557848 GAGCGCTGGGCGCAGGAGCGTGG - Intergenic
1176144118 20:63557899-63557921 GAGCGCTGGGCGCAGGGGCGTGG - Intergenic
1176144140 20:63557972-63557994 GAGCGCTGGGCGCAGGGGCGTGG - Intergenic
1176446910 21:6829468-6829490 AAGAGCTGGGCCCTGGCTCTGGG + Intergenic
1176825081 21:13694494-13694516 AAGAGCTGGGCCCTGGCTCTGGG + Intergenic
1179710410 21:43210002-43210024 GACAGCCGGGTGCTGGCCCAGGG - Intergenic
1180914860 22:19479037-19479059 GGGGGCTGGGCCTTGGCCCGGGG - Intronic
1180976945 22:19853848-19853870 GGGAGCTGGGCCCTGGATCGGGG - Intronic
1182319490 22:29469459-29469481 AAGTGCTGGGTGCTGGCCCAAGG - Intergenic
1182829142 22:33290625-33290647 GAGAGCTGGGGGCTGGCAGCTGG + Intronic
1183234401 22:36606447-36606469 AAGAGCTGGGCTCTGACCCCGGG + Intronic
1183336204 22:37248204-37248226 GTGAGCTGGGCGGTGGCTGGGGG - Intergenic
1183357642 22:37368204-37368226 CAGAGCTGGGCTCAGGCCCTGGG - Exonic
1183381446 22:37492410-37492432 GGGTGCTGGGGGCTGGCCTGGGG - Intronic
1183521943 22:38300664-38300686 GAGAGCTGGGCCCCAGCCAGTGG + Intronic
1183587646 22:38762385-38762407 GAGGGGTGGGGGCTGGCCTGGGG - Intronic
1184464560 22:44661170-44661192 GGGAGCTGGGGGCTGGCGGGAGG - Intergenic
1184464580 22:44661235-44661257 GGGAGCTGGGGGCTGGCGGGAGG - Intergenic
1184467536 22:44677618-44677640 GAGCCTTGAGCGCTGGCCCGTGG - Intronic
1184665017 22:45983753-45983775 GAGTGCTGGGCTCGGGCCCCAGG - Intergenic
1184693066 22:46126095-46126117 GAGAGCTGAGAGCAGGGCCGGGG - Intergenic
1185215719 22:49598970-49598992 GAGAGCTTGAAGCTGGCCTGGGG - Intronic
1185258473 22:49849204-49849226 GAGACCTGGGCGCTGTTCTGGGG + Intergenic
1185383673 22:50521881-50521903 GGGAGCTGGGGGCTGGGCCAGGG + Intronic
950118235 3:10464893-10464915 CAGAGCTGGGCTCAGGCCCAAGG + Intronic
950125939 3:10509831-10509853 GAGAGCTGGGAGTTGGACCCAGG - Intronic
950504948 3:13388884-13388906 CAGAGCTGGGCGCTAGGCCGGGG - Intronic
950524406 3:13515759-13515781 GACAGCTGGGGGCTGGACCTTGG - Intergenic
950872719 3:16243370-16243392 GCGAGCTGGGCTCTGACCTGAGG - Intergenic
950893606 3:16427717-16427739 GAGAAGTGGGCCCTGGCCTGAGG + Intronic
952277421 3:31891008-31891030 GAGAGATGGGAGCTGTCCTGTGG + Intronic
955340518 3:58121809-58121831 GTGAGCTGGGTGCTGGGCAGAGG - Intronic
956695881 3:71919104-71919126 GAGAGCTGGGCTCTGTCCTGAGG - Intergenic
957133739 3:76257039-76257061 TAGAGGTGGGGGCTGGGCCGAGG - Intronic
961652207 3:128422248-128422270 GAAAGCTGGGCGCAGGCCTTGGG + Intergenic
961653784 3:128430368-128430390 GAGAGCTGGGCACTGGAGTGGGG + Intergenic
963925268 3:150944478-150944500 GAGAGATGGGGGCTGGCCTACGG + Intronic
967991966 3:195138278-195138300 GAGAGCTGGACACTGGCTGGAGG + Intronic
968000266 3:195200803-195200825 GAATGCTGGGCTCTGGCCTGTGG + Intronic
968562227 4:1290085-1290107 GGGAGCTGGGCGCGGCCTCGCGG + Intronic
968640392 4:1711856-1711878 GAGAGGTGGGCGCGGGACCCGGG - Exonic
968701456 4:2059920-2059942 GGGAGCTCCGCGCCGGCCCGAGG - Intronic
968878962 4:3288832-3288854 GAGAGCTGGGAGCTGGGACCTGG - Intergenic
969174312 4:5387073-5387095 GAGAGCTGGGCGGTGGCCCCTGG + Intronic
969350181 4:6593784-6593806 GTGTGCTGGGCACTGCCCCGTGG + Intronic
969612645 4:8235890-8235912 CAGACCTGGGCCCTGGCCCTGGG - Intronic
969667893 4:8572563-8572585 GAGACCAGGGGGCTGGCCTGGGG - Intronic
971151109 4:24032428-24032450 GTCAGCTGGGAGCTGGCCCTTGG - Intergenic
971480922 4:27114423-27114445 GAGAGCTGTACGCAGGCCCTGGG - Intergenic
976390410 4:84499405-84499427 GCGAGCCGGGCGCAGGCCGGGGG + Intergenic
982281001 4:153683981-153684003 GAGAGCTGGGGGCTTGGCGGAGG - Intergenic
984989372 4:185364198-185364220 GAGAGATGGGAGCTGACCCTTGG + Exonic
985493131 5:190825-190847 GAGAGCTGGGGGCTCATCCGAGG + Intergenic
985806122 5:2044708-2044730 GAGAGCTGGGAGGTGGCGGGAGG - Intergenic
985870254 5:2548762-2548784 GAGGGCAGGGGGCTGGCACGAGG - Intergenic
987303486 5:16617195-16617217 GGGAGCTGGGCGGTGTCCCCGGG + Intergenic
990879160 5:60520606-60520628 AAGATCTGAGTGCTGGCCCGGGG - Intronic
991566749 5:68012799-68012821 GAGACCTGGGCTCTGGTCCCAGG + Intergenic
997206475 5:132053292-132053314 GAGAGCTGGGCTCAGGTCCTGGG - Intergenic
997265171 5:132490990-132491012 GAGCGCTCGGGGCGGGCCCGCGG - Intergenic
999300156 5:150485999-150486021 GGGAGGTAGGCGCTGGGCCGAGG + Intronic
999327629 5:150652867-150652889 GAGAGCTGGGTTCTAGCCCCAGG + Exonic
999707318 5:154285450-154285472 GAGAGCTGGGCTCAGGTCCCAGG + Intronic
1001405524 5:171474433-171474455 GAGAACTGGGCGCGGGCCAGAGG + Intergenic
1002076542 5:176711918-176711940 GAGTGCTGGGGGATGGCCCCGGG + Intergenic
1002123264 5:177022254-177022276 CAGAGCTGGGAGCTGGCACTTGG + Intronic
1002185979 5:177454984-177455006 GAGAGTGTGGCGCGGGCCCGGGG + Exonic
1003112174 6:3259371-3259393 GGGAGCTGCGCGCGGGCCCCGGG + Intronic
1006436948 6:34030632-34030654 GAGAGCTAGGCACAGGCCCCTGG - Intronic
1006459889 6:34152221-34152243 GAGAGCTGGACGTAGGCCCCGGG + Intronic
1007381478 6:41492890-41492912 GAGTGCTGGGGGCTGGCTGGTGG - Intergenic
1007635569 6:43297953-43297975 GAGAGCTGGCCCCAGGCCCCAGG + Intronic
1007654259 6:43442776-43442798 GAAAGCTGAGTGCTGGCCCTGGG + Intronic
1007740478 6:44006555-44006577 GAGGGCTGGGGGCTGACCCCAGG + Intergenic
1016936408 6:149451651-149451673 AAGATCTGGGCGCGGGGCCGAGG + Intronic
1017713476 6:157190641-157190663 GTGCGCTGGGCGCTAGCTCGTGG + Intronic
1019188046 6:170232555-170232577 GAGAGCTGCACTGTGGCCCGAGG + Intergenic
1019319652 7:409789-409811 GAGGGCTGGGGGCTGGCAGGAGG + Intergenic
1019509255 7:1409113-1409135 GGCAGCTGGGTGGTGGCCCGAGG + Intergenic
1019512014 7:1422335-1422357 GAGACCAGGGCCCTGGCCAGGGG + Intergenic
1019776920 7:2917324-2917346 GAGAGACGGGGGCTGACCCGGGG + Exonic
1019949276 7:4358157-4358179 GGGAGCTGGGCGCAGGCTCATGG + Intergenic
1020224883 7:6272387-6272409 GAGGGCGCGGCGCTGGGCCGGGG - Intronic
1021886424 7:25144372-25144394 GAGAGCCAGCCGCTGGCCCCTGG + Intronic
1022473928 7:30698269-30698291 GAGAGCTAGGCGCAGGGCCTGGG + Intronic
1023286962 7:38630881-38630903 GCGCGCTGGGAGCCGGCCCGGGG + Intronic
1026462867 7:70630226-70630248 GAAAGCTGGGCTCTGGCTGGAGG + Intronic
1027232669 7:76281752-76281774 CAGAGCCGGGCTCGGGCCCGGGG - Exonic
1029115907 7:98236947-98236969 GGAATCTGGGCGCAGGCCCGGGG + Intronic
1029223449 7:99008314-99008336 TGGAGCTGAGCACTGGCCCGCGG + Intronic
1029437900 7:100573042-100573064 GGGAGCTGTGCGGTGGCCTGAGG - Intronic
1031528430 7:122849770-122849792 GAGGGCTGGGGGCTGGCTTGGGG - Intronic
1033476954 7:141701460-141701482 GAGCTCAGGGCGCTCGCCCGGGG + Intronic
1034147175 7:148883946-148883968 GTGAGCTTCGGGCTGGCCCGCGG - Intronic
1034197977 7:149262486-149262508 GCGGGCTGGGCGATGGGCCGGGG - Intronic
1034298294 7:149993309-149993331 GAGAGCGGGGAGCTGGCCAGTGG + Intergenic
1034455800 7:151168956-151168978 GATTGCTGGGGGCTGGCCCCAGG + Intronic
1034807721 7:154103474-154103496 GAGAGGGGGGAGCTGGCCAGTGG - Intronic
1035185865 7:157125504-157125526 CAGAGCTGAGCGCCGGCCCCAGG + Intergenic
1035388198 7:158488646-158488668 CAGGGCAGGGCGCTGGCCTGGGG - Intronic
1036661405 8:10711330-10711352 GAGTGCTGGGAACTGGCCCCGGG - Intronic
1039064790 8:33598933-33598955 GAGAGCTGGGCCCTGTCTAGGGG - Intronic
1039515938 8:38133665-38133687 GTGAGCTTGCCGCTGGCCAGTGG - Intronic
1039873692 8:41567680-41567702 CAGAACTGGACGGTGGCCCGCGG - Intergenic
1040285736 8:46099549-46099571 GAGCCCTGGGCTCTGGCCCCAGG + Intergenic
1042858890 8:73294468-73294490 GCGGGCTGGGGGCTGGGCCGGGG + Intronic
1044587824 8:93884445-93884467 GAGAGCTGGTAGCTGGCTCCAGG - Intronic
1049787397 8:144457563-144457585 GAGGGCTGGGTGCTGTCCTGAGG - Intronic
1053163540 9:35829439-35829461 AAGGGCTGGGCCATGGCCCGGGG - Intronic
1053285110 9:36845160-36845182 GAGACCTGGACACTGGCCTGTGG - Intronic
1055150881 9:72997764-72997786 GTGAGCTGGGCGATGGCCAGGGG + Intronic
1055611751 9:78031478-78031500 GGGAGGCGGGCGCTGGCTCGGGG + Intergenic
1056816178 9:89802879-89802901 GGGAGCTGGGCCCTGGGCCAGGG - Intergenic
1060514601 9:124258033-124258055 GGGACCGGTGCGCTGGCCCGCGG - Exonic
1060552820 9:124493663-124493685 GAGAGCTCTGCGTAGGCCCGGGG - Intronic
1060554832 9:124502916-124502938 GAGAACCGGGCGCTGGCGCTGGG - Intronic
1060757925 9:126226280-126226302 GAGTGCTGGGGGCTGCCCCAGGG - Intergenic
1060815485 9:126632960-126632982 GTGAGCTGGGGGCTCGCCTGCGG - Intronic
1060979389 9:127783990-127784012 GAGAGCTGGGAGCCACCCCGAGG + Intergenic
1061281054 9:129597759-129597781 GACAGGTAGGCGCTGGCCTGAGG - Intergenic
1061926113 9:133806827-133806849 CAGAGCAGGGCGCTGGCACCAGG - Intronic
1062035906 9:134382414-134382436 CAGAGCTGGGGGCTGGGGCGGGG + Intronic
1062265416 9:135684616-135684638 GAGAGCTAGACGCTGCTCCGTGG + Intergenic
1062344392 9:136108236-136108258 GAGAGCTGGGGGCAGGCCCAAGG + Intergenic
1062399099 9:136364679-136364701 GAGAGCTTGGCGCTGAGCTGAGG - Intronic
1062422491 9:136489867-136489889 GGGACCTGGGTGCTGGCCCTGGG - Intergenic
1062544595 9:137055776-137055798 GGGAGCTGGACTCTGCCCCGGGG + Intergenic
1203522280 Un_GL000213v1:55063-55085 AAGAGCTGGGCCCTGGCTCTGGG - Intergenic
1185502253 X:606850-606872 GAGAGATGCTCGCTGGCCTGTGG - Intergenic
1186516103 X:10167032-10167054 GAGTGCTGGGGGCAGGGCCGGGG + Intronic
1190301393 X:49059437-49059459 GAGAGCTGGGCCCTGGGTTGGGG - Intronic
1192161820 X:68794124-68794146 GAGAGCTGGGCTCAGGCCTGGGG - Intergenic
1193251049 X:79290923-79290945 GAGAGTTGGGAGCTGGTCCTTGG - Intergenic
1197718556 X:129728219-129728241 GGGAGCTGGGGGCTGGCCTGGGG + Intergenic
1197749859 X:129957092-129957114 GAGAGCTCGGGTCTGGGCCGGGG + Intergenic
1198028863 X:132735679-132735701 TATAGCTGGGCTTTGGCCCGAGG + Intronic
1199672970 X:150162010-150162032 GAGAGCTGGGCTCTTGCACTGGG + Intergenic
1200123042 X:153800250-153800272 AAGAGCTGGGCGCTCACCCCAGG + Intergenic