ID: 1150336976

View in Genome Browser
Species Human (GRCh38)
Location 17:64337440-64337462
Sequence AGGGATAATACAGTGACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 7, 3: 53, 4: 294}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150336971_1150336976 21 Left 1150336971 17:64337396-64337418 CCTGTGTTTTTAAACTGAAATTG 0: 1
1: 0
2: 3
3: 40
4: 379
Right 1150336976 17:64337440-64337462 AGGGATAATACAGTGACTGTGGG 0: 1
1: 0
2: 7
3: 53
4: 294
1150336970_1150336976 24 Left 1150336970 17:64337393-64337415 CCTCCTGTGTTTTTAAACTGAAA 0: 1
1: 0
2: 3
3: 43
4: 335
Right 1150336976 17:64337440-64337462 AGGGATAATACAGTGACTGTGGG 0: 1
1: 0
2: 7
3: 53
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150336976 Original CRISPR AGGGATAATACAGTGACTGT GGG Intronic
902775506 1:18672014-18672036 AGGAATAATAAAGTTCCTGTTGG + Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
908093020 1:60706648-60706670 AGGGAAAGTGAAGTGACTGTGGG + Intergenic
908363273 1:63390800-63390822 AGGGAGAGTGCAGTGACTATGGG - Intronic
910188475 1:84571219-84571241 AGGCAGAATACAGAAACTGTTGG + Intronic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
910959627 1:92747956-92747978 AGGGAAGATACAGTCACTGGAGG - Intronic
912633375 1:111268303-111268325 AGGAAGAACACAGTGATTGTAGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912873241 1:113328863-113328885 AGGGAGAATGCAGTAATTGTGGG - Intergenic
914425724 1:147573874-147573896 TGGCATAATGCAGTGACAGTGGG - Intronic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
915979765 1:160412765-160412787 AGGGAAACTATAATGACTGTAGG - Intronic
917171677 1:172183445-172183467 AAGGAAAATACAGTGATTCTGGG + Intronic
917201492 1:172521121-172521143 AGGGATAATGCAAAGTCTGTGGG + Intergenic
917239370 1:172930981-172931003 AGGAATAATACAGTGAACTTTGG + Intergenic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917373210 1:174317941-174317963 AGGGAGAACACAGCAACTGTGGG - Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
918286045 1:183055951-183055973 AGAGATTATAGAGTTACTGTTGG + Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
918462711 1:184792773-184792795 AGGGATATTAAAGTGACTCAAGG + Exonic
919067665 1:192713886-192713908 AGGGAGAATGCATTGAGTGTGGG + Intergenic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
920596827 1:207280192-207280214 AGGGAGAGCACAGTTACTGTGGG - Intergenic
921002146 1:211055257-211055279 AGGAAAAACACAGTGATTGTGGG + Intronic
921906085 1:220496768-220496790 AGAGTTAAAACAGTGACTGGCGG - Intergenic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
1064154216 10:12890171-12890193 AGTGATAAAACTGTGTCTGTGGG + Intergenic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1065810031 10:29433774-29433796 ATGTATAATAAATTGACTGTAGG + Intergenic
1066194728 10:33088175-33088197 AGGTAGAATAGAGTGACTCTAGG - Intergenic
1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1070059556 10:72968675-72968697 AGGGAAAGTACAGTAACTGGGGG - Intergenic
1073827212 10:107337478-107337500 AGGGAGATCACAGTGACTGGGGG - Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1081522161 11:43892885-43892907 AGGGAGAAAACATTGACTGAGGG + Intronic
1081943844 11:46970111-46970133 AGGGACTAGACAGTGGCTGTAGG + Intronic
1084763960 11:71295401-71295423 AGGTATAATGCAGTGATTGTGGG - Intergenic
1087295956 11:96374175-96374197 ATGTATTCTACAGTGACTGTTGG - Intronic
1088536900 11:110871391-110871413 AGGGATCTTACAGTTAGTGTGGG - Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1089344602 11:117782958-117782980 ATGGTTAAGACAGTGACTGTAGG - Intronic
1090923093 11:131224482-131224504 AGGGATAATACAGGGATTGCAGG + Intergenic
1092477141 12:8828950-8828972 CGGGAGAGCACAGTGACTGTGGG - Intronic
1092991208 12:13901833-13901855 AGGTAAAATACAGAGACTATAGG - Intronic
1093531900 12:20175252-20175274 AGAGAGAGTCCAGTGACTGTGGG - Intergenic
1093734903 12:22609686-22609708 AGGAGTGATACAGTGACTGGAGG - Intergenic
1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG + Intergenic
1093955496 12:25213197-25213219 ATGTTTTATACAGTGACTGTAGG - Intronic
1095129943 12:38528862-38528884 AGGGATAAAACAGAGAATTTAGG + Intergenic
1095199331 12:39364122-39364144 GGTGATAATTCAGTGACAGTAGG - Intronic
1095592948 12:43925209-43925231 AGGCATAATTCAGTGTGTGTGGG + Intronic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1096271322 12:50167907-50167929 AGGGATAAAGCAGTGAAAGTAGG - Intergenic
1099101011 12:78440094-78440116 AGGGAGAGCAAAGTGACTGTGGG - Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1099781570 12:87202330-87202352 TGAGATAATACAGTGATTGTGGG + Intergenic
1101570129 12:105946185-105946207 TTTGATAATACAGTGACTCTAGG - Intergenic
1101672774 12:106892210-106892232 GGGTATACTACAGTGACTGCTGG - Intergenic
1103943505 12:124513470-124513492 AGGGATAGTAGAGGGACTTTTGG + Intronic
1107765752 13:43732797-43732819 AGAGAAAATGCAGTGAGTGTTGG - Intronic
1107803463 13:44132115-44132137 AGGGATAGGACAGTAACTGCAGG + Intergenic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1110103349 13:71637092-71637114 ATGTATAATACAGTGGCTGGGGG + Intronic
1110542274 13:76719959-76719981 AGGGATAGTACAGTGGCAGCAGG + Intergenic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1111569424 13:90062579-90062601 AGTGATATTACAATGGCTGTAGG - Intergenic
1111750496 13:92325423-92325445 AGGAATAACACAGCAACTGTGGG - Intronic
1111939129 13:94590721-94590743 ATGGATAACACAGTCACCGTGGG + Intronic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113244428 13:108378253-108378275 AGGGATAGCACAGTGACTGTGGG - Intergenic
1113834287 13:113318744-113318766 AGGGAGAAGGCAGTGAGTGTGGG - Intronic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116765844 14:49069923-49069945 GGGGAAAACACAGTGACTGTGGG + Intergenic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117870657 14:60197452-60197474 AGGGAGGACAAAGTGACTGTGGG + Intergenic
1118662462 14:68029045-68029067 AGGGTTAATGAAGAGACTGTGGG - Intronic
1119157083 14:72421313-72421335 AGGGATTATAGAGTGAGGGTGGG + Intronic
1119913572 14:78373814-78373836 AGAGATAATACAGTATATGTGGG - Intronic
1120362287 14:83520081-83520103 AGGAATAAAACACTGACTTTTGG + Intergenic
1123988653 15:25667083-25667105 CGGGATGATCCAGAGACTGTTGG - Intergenic
1124217119 15:27816696-27816718 AGGGAAAATTCAGTAGCTGTAGG - Intronic
1129030751 15:72616017-72616039 AGGGAGAATGCAGCAACTGTGGG - Intergenic
1129477594 15:75796541-75796563 AGGGAGAATACAGCAACTGTGGG - Intergenic
1129835661 15:78703818-78703840 AGGGAGAATGCAGCAACTGTGGG - Intronic
1130058459 15:80551092-80551114 ATCGAAAATACAGTGAGTGTTGG - Intronic
1130511674 15:84594818-84594840 AGGGAGAATGCAGCAACTGTGGG + Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1140450504 16:75066857-75066879 AGGGCTATTTCAGTAACTGTGGG + Intronic
1142919139 17:3169345-3169367 AGAGAGAATGCAGTGAGTGTGGG + Intergenic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1145328509 17:21851095-21851117 AGGGATACTGCAGTGGCAGTGGG + Intergenic
1145995911 17:29104877-29104899 AGGGATAGTAAAGTGCCAGTTGG + Intronic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1148813708 17:50311773-50311795 AGTGATATTAAAGTGACTGTTGG + Intergenic
1148841817 17:50503667-50503689 AGGGATGACACAGAGACTCTGGG - Intergenic
1150336976 17:64337440-64337462 AGGGATAATACAGTGACTGTGGG + Intronic
1153072180 18:1117957-1117979 AGGGATGAAAGACTGACTGTTGG - Intergenic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1155046069 18:22104317-22104339 AGATACAATACAGTGACTATAGG + Intergenic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155767349 18:29652369-29652391 AGGGAGAATGCAGTGAATGTGGG + Intergenic
1156039106 18:32799731-32799753 AAGTATAAGACAATGACTGTTGG + Intergenic
1156977356 18:43238629-43238651 AGGGGCAACACAGTGACTGGAGG - Intergenic
925506439 2:4569891-4569913 AGAGAAAACACAGTGATTGTGGG - Intergenic
925526175 2:4804876-4804898 TGGGAAAATACACTGACTTTGGG + Intergenic
928293443 2:30060606-30060628 AGGGAAAACACAGTGATTCTGGG + Intergenic
928468050 2:31541776-31541798 ATGGACAGTACAGTGATTGTGGG + Intronic
929278069 2:40046796-40046818 AGGGATAATCAAGTGGCTGAAGG - Intergenic
929281837 2:40088203-40088225 AAGGAAAGTGCAGTGACTGTGGG - Intergenic
929493127 2:42415325-42415347 AGCAATAATACAGTTACTATAGG - Intronic
930161635 2:48164304-48164326 TAGGATATTACAGTGACTCTGGG + Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
930606188 2:53495908-53495930 AAGGATAATGCAATGAGTGTTGG - Intergenic
935252062 2:101272179-101272201 CGGGATTATACAGGTACTGTTGG - Intronic
935619278 2:105114605-105114627 GGGGAAAATACAGTGATTTTTGG + Intergenic
935994195 2:108750255-108750277 AGTTTTAATACAGAGACTGTGGG - Intronic
936511403 2:113150406-113150428 AGGGATAGTGCAGTGATTGCCGG - Intergenic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
937379708 2:121365523-121365545 AGGGTGAAGACATTGACTGTTGG - Intronic
938549838 2:132369891-132369913 AGGGATAAATCATTCACTGTGGG + Intergenic
938587636 2:132707207-132707229 GGGGAAAGTGCAGTGACTGTGGG + Intronic
939144423 2:138395703-138395725 AGAGAGACTGCAGTGACTGTGGG + Intergenic
939457729 2:142460054-142460076 AGGGCTATTAGAGAGACTGTTGG - Intergenic
940595925 2:155792965-155792987 AGGGAAAATACAGAGAATGGTGG + Intergenic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943099656 2:183472223-183472245 AGGGAGAGTGCAGTGACTATGGG - Intergenic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
943933490 2:193885306-193885328 AGGGAGAATAAAGTGACTGGTGG + Intergenic
944129785 2:196335327-196335349 AGAGAAATTCCAGTGACTGTAGG - Intronic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
945165210 2:206936002-206936024 ATGGATAATACATTGACTTATGG - Intergenic
945966964 2:216198414-216198436 AGGCATGATACAGTGACAGGTGG - Intronic
946054926 2:216892817-216892839 ATGGTTGCTACAGTGACTGTTGG - Intergenic
946336427 2:219040309-219040331 AGGGATAAGAGAGTGTCTGATGG - Intronic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1169294332 20:4380225-4380247 AGGTATAGTACAGTGTCTCTTGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170142006 20:13133775-13133797 AGGGATGGTCCAGTGATTGTAGG + Intronic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1170864221 20:20138508-20138530 AGAGAAAGTGCAGTGACTGTGGG - Intronic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1173190705 20:40873534-40873556 AGGGATTTTACAGTTACTGAAGG + Intergenic
1176940060 21:14912637-14912659 AGGGAGAATGCATTGATTGTGGG - Intergenic
1177902388 21:26932943-26932965 AGGGTTATTACAGTGACGATAGG + Exonic
1179107863 21:38419405-38419427 AGGGATAATTCAGTGCCTACAGG - Intronic
1179570227 21:42274188-42274210 AGGGAAAATACAGGGAAGGTGGG + Intronic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
949972620 3:9423206-9423228 AATGATGATACAGAGACTGTTGG + Intronic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
951637404 3:24794786-24794808 TAGGATAATCCATTGACTGTTGG - Intergenic
952066559 3:29577719-29577741 AGGGAGAATACAGCAACTGGGGG - Intronic
952132930 3:30385222-30385244 AGGGAGAGTACAGCAACTGTGGG - Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
952862280 3:37823054-37823076 AGGGAGAATACAGAGCCAGTAGG + Exonic
954491478 3:50910709-50910731 AGGGAGAACAAAGTGACTGTGGG - Intronic
955786585 3:62547182-62547204 AGGGATAATAAAGTAACCATGGG + Intronic
956605762 3:71071478-71071500 AGGAATAATAGTGTGATTGTGGG + Intronic
957532920 3:81463455-81463477 AGGTTTAATACAATGACTTTGGG + Intergenic
957538098 3:81532020-81532042 AGGGAAAACACAGTGACTGTGGG - Intronic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958147005 3:89639277-89639299 AGAAAGAATACAGTGACTGTGGG + Intergenic
958682691 3:97352489-97352511 AGAGAGAATGCAGTGACTGTGGG + Intronic
958819756 3:98959725-98959747 TGAGATAATACAGTGAATGATGG + Intergenic
959191072 3:103112399-103112421 AGGGAGACTGCAGTGACTGGGGG + Intergenic
959448400 3:106468064-106468086 ATTGATAATGCAGTGACTGTGGG - Intergenic
959806710 3:110562855-110562877 AAGGAGAATGCAGTGATTGTGGG - Intergenic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
961569276 3:127786477-127786499 AGGGAGAAGGCAATGACTGTGGG + Intronic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
965264052 3:166518184-166518206 AGGGAAAGTGCAGTTACTGTGGG + Intergenic
965535362 3:169818169-169818191 AGGGAGAGGAAAGTGACTGTGGG - Intergenic
965844395 3:172945580-172945602 AGGGAGAATACAGTAATTGTGGG + Intronic
965853942 3:173065698-173065720 AGGGAAAGTAAAGTGAGTGTGGG + Intronic
966106796 3:176345538-176345560 AGGAATGATGCAGTCACTGTTGG + Intergenic
966454107 3:180095059-180095081 AGGGAGAACACGGTGATTGTGGG - Intergenic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
971850847 4:31984988-31985010 AGGCATGAAACAGTGACAGTGGG - Intergenic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
974266905 4:59597704-59597726 AAGGATAGTGCAGGGACTGTGGG + Intergenic
975095753 4:70454453-70454475 AGGGAGCATGCAGTGCCTGTGGG - Intronic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
976684166 4:87792512-87792534 AGGTACATTACAGTGAGTGTGGG + Intergenic
977418936 4:96772622-96772644 AGGTATACTACTGTGACTATTGG + Intergenic
977839509 4:101685274-101685296 AGGGATAGTACAGTGCCGGCTGG + Intronic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
979834528 4:125346995-125347017 AGATATAATTCAGTGACTCTAGG + Intronic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
982911454 4:161148057-161148079 AGGAAGAGTACATTGACTGTAGG + Intergenic
983060928 4:163159807-163159829 AGGGATAATAATGTGTCTTTAGG - Intronic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983417627 4:167479369-167479391 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
984572967 4:181415369-181415391 AGAGAAAATACACTGACTCTGGG - Intergenic
985347024 4:189016947-189016969 AGAGAAAATACAGTTCCTGTTGG - Intergenic
985487367 5:158980-159002 AGGGAAACTAAAGTGACTGCTGG - Intronic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
987269648 5:16293376-16293398 AGGGATTATAGAGAGACTGAGGG - Intergenic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
987886184 5:23815904-23815926 AGGGAGAGTAAAGTGAGTGTGGG + Intergenic
990299790 5:54438455-54438477 AGGGATAATGCAGTGTCTCCAGG - Intergenic
991151359 5:63375017-63375039 AAGGATAATACTGTGATTGCAGG - Intergenic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991989390 5:72322342-72322364 AGGCATAATAAAGTCACTGAAGG - Intronic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993138253 5:83997828-83997850 AGGGAGAATGAAGTGATTGTGGG + Intronic
993279264 5:85904750-85904772 AGGGAAAGTGCAGTGACTGAGGG + Intergenic
993287454 5:86017133-86017155 ATGGAGAGTACAGTGACTGGAGG - Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
995421632 5:111974105-111974127 AGGGAAAACACAGTCACGGTAGG - Intronic
996126668 5:119733576-119733598 AGGGATATTATTGTGACAGTTGG - Intergenic
997437824 5:133887703-133887725 AGGGACAGTCCAGTGACTGTGGG + Intergenic
999279465 5:150355488-150355510 AGGGAGAAGACAGTGTATGTGGG - Intergenic
999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG + Intergenic
1001845255 5:174916445-174916467 AGGGAGAATGCAGCAACTGTGGG + Intergenic
1006343846 6:33463889-33463911 TGGATTAATACAGAGACTGTGGG + Intergenic
1007064511 6:38976332-38976354 TGTGACAATACAGTGAGTGTAGG + Intronic
1008101147 6:47392495-47392517 AGGGAGACAACAGTGACTGTGGG - Intergenic
1008192267 6:48474838-48474860 AGGAAGAATGCAGTAACTGTGGG + Intergenic
1008481293 6:51988514-51988536 AGAAATAAAACAGTGGCTGTTGG - Intronic
1008727918 6:54443529-54443551 TGGCATCATACATTGACTGTGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010073589 6:71773254-71773276 AGTCATATTACAGTGACTCTGGG + Intergenic
1010700500 6:79039009-79039031 AGGGATTAAACAGTCACAGTGGG - Intronic
1011971468 6:93229195-93229217 AGGGCTAATACAGAGGGTGTGGG + Intergenic
1012073796 6:94657774-94657796 AGGGAGAAAGCAGTGACTGATGG - Intergenic
1013838816 6:114365301-114365323 AAGGAAAATACATTAACTGTGGG - Intergenic
1015392788 6:132701848-132701870 AAGGAAAGTACAGTGATTGTGGG + Intronic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1016927462 6:149365803-149365825 ATGAATAAAAAAGTGACTGTGGG - Intronic
1017751245 6:157492208-157492230 AGGGAGACTACAGTGGCTGGGGG - Intronic
1020813209 7:12871864-12871886 AGGTATAAGACAGTTACTATGGG - Intergenic
1021123629 7:16825635-16825657 AGGGAGAATGCAGTGATTATGGG + Intronic
1021922978 7:25505713-25505735 AGGGACAGCACAATGACTGTAGG + Intergenic
1022217821 7:28281656-28281678 AGGGATGGTCCAGTGACAGTGGG - Intergenic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1024705956 7:51959785-51959807 AGGAAGAATGCAGTGACTGGGGG - Intergenic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1027127273 7:75565677-75565699 AAGGATAATAGAGTGAGAGTTGG - Intronic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1028868178 7:95737092-95737114 AAGGAGAACCCAGTGACTGTGGG - Intergenic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1029042610 7:97593395-97593417 AGGGAGAGTGCAGTGGCTGTGGG - Intergenic
1030891413 7:115003567-115003589 AGTGATAATATAGTGCCAGTGGG - Intronic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031412599 7:121457440-121457462 AGGGAGAATGCTGTGACTGTGGG - Intergenic
1031615128 7:123870897-123870919 AGTGATAATAAATTGACTTTTGG + Intronic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1033410131 7:141109772-141109794 AGGAATAAAAAACTGACTGTTGG + Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1039126467 8:34207847-34207869 AAGGAAAATAAAGTAACTGTTGG + Intergenic
1039681921 8:39748804-39748826 AGAGAATATACAGTCACTGTTGG - Intronic
1040418089 8:47214125-47214147 AGAGATAATCAAGAGACTGTTGG - Intergenic
1040929994 8:52723551-52723573 AGGGACAGAATAGTGACTGTTGG - Intronic
1041396670 8:57398723-57398745 AGGGTTAATACAGTGAGGGTCGG + Intergenic
1041744881 8:61197878-61197900 AGGGAGAGAACAGTGACTATAGG - Intronic
1043079972 8:75754838-75754860 AGGGAGAGTGCAGTGACTATGGG + Intergenic
1043578321 8:81683247-81683269 AGGGATAAGACATTGATTGAAGG + Intronic
1044149320 8:88754849-88754871 AAGGACAATTCAGTGAGTGTGGG - Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047626423 8:126660670-126660692 AGGGATAGTCCAGTGGCAGTGGG + Intergenic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1048198455 8:132351809-132351831 AGGGATAAGACAATCACTTTGGG + Intronic
1050644410 9:7703295-7703317 AGGGAGAATACAGTCACTGAGGG - Intergenic
1051039219 9:12785665-12785687 AGGGAGAATACAGTGATTATGGG - Intronic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1051880946 9:21839433-21839455 AGGCAAAATACAGTGACTTGGGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052450602 9:28625284-28625306 AGGGAGAACACAGTGACTTAGGG - Intronic
1052758128 9:32562499-32562521 ATAGATAATCCAGTGAATGTTGG - Intronic
1053050133 9:34954594-34954616 TGGGATATTAAAGAGACTGTGGG - Intergenic
1053317144 9:37061617-37061639 AGGGGTAACACAGTTACGGTGGG - Intergenic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1056338703 9:85602853-85602875 AGAGAACATGCAGTGACTGTGGG + Intronic
1056516665 9:87358799-87358821 AGAGAAAGTGCAGTGACTGTGGG + Intergenic
1057501892 9:95602750-95602772 AAGGATAATACAGTGTATGAAGG - Intergenic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1061233410 9:129328124-129328146 AGGGACAACTCAGTGGCTGTGGG + Intergenic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1187636677 X:21237417-21237439 AGGGAGAACATAGTGACTGTGGG + Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188938567 X:36208469-36208491 ACAGAAAATACAGTGTCTGTGGG - Intergenic
1189254806 X:39629645-39629667 AGGAATAAGACTGTGACTGAAGG + Intergenic
1190122597 X:47674549-47674571 AGGGAGAACACAGTGAATGTGGG - Intergenic
1190754521 X:53390177-53390199 AGGGATAATAAAGTGTCAGGGGG + Intronic
1192046107 X:67675597-67675619 AGGAAGATTGCAGTGACTGTGGG - Intronic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1192875348 X:75223645-75223667 AGGGAAACTGCAGTGATTGTGGG - Intergenic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193933198 X:87582386-87582408 AGGGATAACACAGCAATTGTGGG + Intronic
1194329120 X:92559648-92559670 AGGAATATTGCAGTGACTGGGGG + Intronic
1194388930 X:93292459-93292481 AGGGAGAATGCAGTGACTGGGGG + Intergenic
1194464750 X:94219561-94219583 AGGGATGGTCCAGTGGCTGTGGG + Intergenic
1194526369 X:94982843-94982865 TGGGAAAGTGCAGTGACTGTGGG + Intergenic
1194751287 X:97687130-97687152 AGCGAAAATACAGTGCATGTGGG - Intergenic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1194882685 X:99273459-99273481 AGGGAGAATACAGCAACTGGAGG + Intergenic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1196928183 X:120654966-120654988 AGTGTTAATGCAGTGCCTGTGGG - Intergenic
1197011478 X:121569974-121569996 AGGGAAAGTACAATGATTGTGGG + Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1198761561 X:140038345-140038367 AGGGAGAGGAAAGTGACTGTGGG + Intergenic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199373545 X:147080974-147080996 AGGAATAATACAGTGCATTTGGG + Intergenic