ID: 1150346865

View in Genome Browser
Species Human (GRCh38)
Location 17:64411302-64411324
Sequence GATGGGTATATGCAGTGGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 1, 2: 2, 3: 18, 4: 125}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150346865 Original CRISPR GATGGGTATATGCAGTGGAT AGG Intronic
901700199 1:11041219-11041241 GATGGGTAGATGAATAGGATGGG + Intronic
903898030 1:26621361-26621383 GAAGGGGTTATTCAGTGGATGGG - Intergenic
907954613 1:59216129-59216151 CATGGGTTCATGCTGTGGATGGG - Intergenic
909361381 1:74763095-74763117 GATGGGAATATTCAGTGTATAGG + Intronic
910941928 1:92545869-92545891 GAGGCGTATATGCAGAGGCTTGG - Intronic
911230212 1:95353182-95353204 GCTTGGTGTATGCAGTGGAGAGG - Intergenic
912638457 1:111320770-111320792 GATGAGGATATGAAGAGGATAGG + Intergenic
916786745 1:168092175-168092197 GATGGGCATGTGCAGGGGAAAGG - Intronic
919932000 1:202227046-202227068 GGTGGGTATTTGCCGTGGAAAGG - Intronic
924271129 1:242333684-242333706 CATGAGGATATGCAGTAGATTGG - Intronic
1065969261 10:30793118-30793140 AATGGTTACCTGCAGTGGATTGG + Intergenic
1066684647 10:37968935-37968957 AATTGGTATATGCAGGTGATTGG - Intronic
1069937396 10:71927217-71927239 GAGAGGCATATGCAGTGGAAGGG + Intergenic
1071777367 10:88804304-88804326 GCTGGGTACACGCAGTGGGTGGG - Intronic
1072259585 10:93656490-93656512 GATGGAAATATTCAGTGGCTTGG + Intronic
1078639204 11:13079621-13079643 CATGGGGATCTGCAGTGGAGAGG - Intergenic
1079488551 11:20961827-20961849 CCTGGGTATATGCAGGGAATTGG - Intronic
1083032016 11:59601574-59601596 GATGGTTTTCTGCAGTTGATAGG - Intronic
1083092566 11:60216171-60216193 GATTGGTAAATGCAGTAAATTGG - Intronic
1085213568 11:74805939-74805961 GCTCGGTATATGTAGGGGATTGG - Intronic
1086501783 11:87461295-87461317 TTTGGGTATATGCACAGGATTGG - Intergenic
1088091579 11:106046402-106046424 TCTGGGTATATGAAGTAGATAGG + Intergenic
1100700745 12:97145218-97145240 AATGGGTTGATGCAGTGGATGGG - Intergenic
1101665700 12:106811573-106811595 GATGGGTAGATGTAGTGGCAGGG + Intronic
1102013045 12:109630820-109630842 GAGGGGAATATACAGAGGATAGG + Intergenic
1103876436 12:124131082-124131104 CATGGGTATGTGTAATGGATTGG - Intronic
1109179967 13:59202071-59202093 GAAGGGCATGTGCAGTGGAGGGG - Intergenic
1109746484 13:66629820-66629842 GATGGGGACATGCTGGGGATTGG + Intronic
1109845690 13:67987571-67987593 GATGGATATAGGTAGAGGATTGG - Intergenic
1111079781 13:83289019-83289041 GATAGGTAGATGCAGTTTATGGG - Intergenic
1116029749 14:39556565-39556587 GATGAGCAAATGCAGTGGAGTGG + Intergenic
1124958334 15:34374950-34374972 GATAGGTCTATTCAGTTGATTGG - Intergenic
1125075914 15:35618082-35618104 GATGAAGATATGCAGTGAATTGG + Intergenic
1125412329 15:39418289-39418311 GAGGGGTACATGCGGTGGATGGG + Intergenic
1125521645 15:40351151-40351173 GGTGTGTATATGCATTGAATTGG + Intronic
1126865353 15:52931444-52931466 GAGGAGTATAAGCAGTTGATTGG + Intergenic
1130328273 15:82899219-82899241 GATGGGCACATGCATTGGCTGGG - Intronic
1130533232 15:84763827-84763849 TGTGGGTATATGTAGTTGATGGG + Intronic
1134906127 16:17981322-17981344 GGTTGGTATACTCAGTGGATGGG - Intergenic
1135205518 16:20480648-20480670 GATGGGTATTTCCAGTTTATGGG + Exonic
1135213389 16:20543165-20543187 GATGGGTATTTCCAGTTTATGGG - Exonic
1140093563 16:71856291-71856313 GCTGGGCATTTGCAGTGGAATGG - Exonic
1141412030 16:83841759-83841781 GAAGGGTCTATCCAGTTGATCGG + Intergenic
1148245122 17:46025351-46025373 GAGGGGTATAGGCAGTGATTGGG - Exonic
1149037471 17:52151259-52151281 ATTGGGCATATGGAGTGGATAGG - Intronic
1150346853 17:64411234-64411256 AGTGGGTATATGTAGTGGATGGG + Intronic
1150346855 17:64411251-64411273 GATGGGCATATGCAGTGAGTGGG + Intronic
1150346860 17:64411268-64411290 AGTGGGTATATGCGGTGGGTGGG + Intronic
1150346863 17:64411285-64411307 GGTGGGCATATGCAGTGGATGGG + Intronic
1150346865 17:64411302-64411324 GATGGGTATATGCAGTGGATAGG + Intronic
1150346876 17:64411353-64411375 GGTGGGCATATGCAGGGGTTGGG + Intronic
1150346878 17:64411370-64411392 GTTGGGTATATGCAGTGGATAGG + Intronic
1150346898 17:64411487-64411509 AGTGGGCACATGCAGTGGATGGG + Intronic
1150346902 17:64411504-64411526 GATGGGCATGTGCAGTGGGTGGG + Intronic
1150346906 17:64411521-64411543 GGTGGGCATATGCAGTGGGTGGG + Intronic
1150346910 17:64411538-64411560 GGTGGGCATGTGCAGTGGGTGGG + Intronic
1150346914 17:64411555-64411577 GGTGGGCATGTGCAGTGGGTGGG + Intronic
1150346918 17:64411572-64411594 GGTGGGCATATGCTGTGGGTGGG + Intronic
1150346921 17:64411589-64411611 GGTGGGCATACGCAGTGGATGGG + Intronic
1150346924 17:64411606-64411628 GATGGGCATGTGCAGTGGATGGG + Intronic
1150346928 17:64411623-64411645 GATGGGCATGTGCAGTGGGTGGG + Intronic
1150346932 17:64411640-64411662 GGTGGGCATACGCAGTGGGTGGG + Intronic
1150346940 17:64411674-64411696 GGTGGGCATGTGCAGTGGGTGGG + Intronic
1150346950 17:64411708-64411730 GGTGGGCATACGCAGTGGGTGGG + Intronic
1150346954 17:64411725-64411747 GGTGGGCATACGCAGTGGGTGGG + Intronic
1150346958 17:64411742-64411764 GGTGGGCATATGCAGTGGGTGGG + Intronic
1150346962 17:64411759-64411781 GGTGGGCATATGCAGTGGGTGGG + Intronic
1150535413 17:66034097-66034119 CCTTGGTATATGCAGGGGATTGG - Intronic
1150887004 17:69098783-69098805 GATGGTTATTTCCAGGGGATGGG + Intronic
1154388690 18:13918218-13918240 GATGGGTATGTTCAGTAGATTGG - Intergenic
1155021552 18:21901414-21901436 AATGGGGATGTGCACTGGATGGG - Intergenic
1157716904 18:49894194-49894216 AATGGGGAGTTGCAGTGGATGGG - Intronic
1157937841 18:51892851-51892873 GAAGGGTATATGAAATGAATAGG + Intergenic
1158080260 18:53581892-53581914 GAGGGGAAAGTGCAGTGGATAGG + Intergenic
1159118487 18:64142319-64142341 GATAGATAGATGCAGTGGAGTGG + Intergenic
1159590760 18:70332687-70332709 CCTGGGTATCTGCAGGGGATTGG + Intergenic
1163218171 19:15895962-15895984 GATGGGTAGATAGAGTAGATAGG - Intronic
1167687869 19:50967965-50967987 GATGGGGATATGCACAGGGTTGG - Intronic
926394111 2:12423841-12423863 GATGGGCAGATGCAGAGGCTGGG - Intergenic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
930348844 2:50223342-50223364 GTTGGATAAATGCAGTGGCTGGG - Intronic
931238218 2:60429719-60429741 GATGGGTCTATGCCGTGTGTTGG - Intergenic
933777143 2:85777976-85777998 GATGGGTAAATGGGGTGGCTGGG + Intronic
934905077 2:98193082-98193104 GATGGTTATGAGCAGTGGATAGG + Intronic
936523643 2:113228151-113228173 CATTGTTATATGCAGTAGATGGG - Intronic
946392889 2:219426897-219426919 GATGTCTGTATGCAGTGTATGGG + Intergenic
1168782599 20:506429-506451 TATGGGTATATGTAGAGGAGGGG - Intronic
1169218079 20:3804784-3804806 GAGGGGTCAATGCAGTGGAATGG - Intronic
1169272594 20:4212075-4212097 GTGGGGTATATGCATTGGAGAGG + Intergenic
1182388318 22:29966839-29966861 AATGGTTAAATGCAATGGATTGG - Intronic
1184599508 22:45534405-45534427 CATGTGTTTATGCAGTGGAAGGG - Intronic
1184626233 22:45732824-45732846 AATGAGTAAATGCAGTGGTTTGG - Intronic
949247438 3:1942010-1942032 AATGGATAAATGGAGTGGATAGG - Intergenic
949359597 3:3217545-3217567 GAGAGGTATTTGCAGTGGAGAGG - Intergenic
953304737 3:41817709-41817731 CATGGGTATATGCTGTGGTTTGG - Intronic
956182616 3:66531556-66531578 GATGAGAATATGCATTGGAATGG + Intergenic
956217387 3:66862679-66862701 GAGGGGTATATCAAGTGGGTAGG - Intergenic
957465583 3:80586171-80586193 GATGCATATAGGCACTGGATGGG + Intergenic
958077687 3:88704257-88704279 GATGGGTATTTACTGTGGAATGG + Intergenic
971801506 4:31298786-31298808 GGTGGGTATCTGCTGTTGATGGG + Intergenic
981269647 4:142830498-142830520 GAGGGGAATATGGAGTGGAGAGG + Intronic
981303712 4:143222296-143222318 CCTTGGTATCTGCAGTGGATTGG + Exonic
986165462 5:5268641-5268663 GGTGGATGTATGCAGTGTATGGG - Intronic
992923722 5:81557646-81557668 GATGGAAAAATGCACTGGATGGG - Intronic
996195748 5:120605003-120605025 GATGACTATATGCATTGGAATGG + Intronic
1000635126 5:163635264-163635286 AATGGGCCTATGCAGTGGTTGGG + Intergenic
1001645900 5:173282164-173282186 GATGGGTCTCTGCCTTGGATGGG + Intergenic
1002770358 6:285510-285532 GGTGGGTAGGTGCAGTGGATGGG - Intergenic
1004144197 6:13049566-13049588 GATGGGTATCTGCATTTGGTTGG - Intronic
1006343837 6:33463806-33463828 GATGGGTAAAGGCAGCAGATAGG + Intergenic
1006555648 6:34863925-34863947 GATGGGTATTGTAAGTGGATGGG + Intronic
1006689479 6:35868768-35868790 GATGGGTATCTGGAGTGGGGTGG + Intronic
1008294802 6:49762278-49762300 GCTGGGCATATGCAATGGTTTGG - Intergenic
1011991974 6:93532877-93532899 GTTGGGTTTATGCAATGTATAGG - Intergenic
1014638320 6:123877459-123877481 GATGGGCATATGGAATGTATGGG + Intronic
1017366999 6:153654941-153654963 CCTGGGTATTTGCAGGGGATTGG - Intergenic
1019103450 6:169650255-169650277 GGTGGGTAGATGGAGGGGATGGG - Intronic
1022569484 7:31437640-31437662 GATGGGTATGTGGAATGAATGGG - Intergenic
1023442689 7:40200671-40200693 GATGGGTCTGAGCAGTGGAGGGG + Intronic
1024097378 7:45993634-45993656 TGTGACTATATGCAGTGGATGGG - Intergenic
1026235236 7:68521371-68521393 GTTGAGTATAAGCTGTGGATTGG - Intergenic
1031348754 7:120702321-120702343 AATGCTTATATGCAGTTGATAGG + Intronic
1033958622 7:146884086-146884108 CCTGGGTATATGCAGGGGATGGG + Intronic
1034124537 7:148659311-148659333 CCTTGGTATCTGCAGTGGATGGG - Intergenic
1035824118 8:2626637-2626659 GCTGGGTATATGCAGAGAGTGGG + Intergenic
1044954139 8:97462239-97462261 TGTGGGTATATGCTGGGGATTGG - Intergenic
1045674634 8:104593585-104593607 CCTTGGTATATGCAGGGGATGGG + Intronic
1045911530 8:107416195-107416217 GATTGGTGTCTGCAGTGGAAGGG - Intronic
1046514991 8:115247493-115247515 GATGGGTGTATGCAGTGCTGAGG - Intergenic
1047860231 8:128957940-128957962 GATGGATGTTTGCAGTGGAGTGG - Intergenic
1051552552 9:18346259-18346281 GCTGGCTATATGCAGTGTCTAGG - Intergenic
1055797797 9:79994315-79994337 GATGGTTTTATGCAGAGGAGTGG - Intergenic
1055850328 9:80620308-80620330 GATGGGTTTAAACAGTAGATTGG - Intergenic
1056043685 9:82694911-82694933 GATGTGTCTATGGTGTGGATTGG + Intergenic
1058997574 9:110315069-110315091 GATGGGCAAATGCAGGGGATAGG - Intronic
1060350786 9:122857815-122857837 GTTGGATATTTGCAGTGGTTTGG - Intronic
1060375671 9:123113677-123113699 GATGGATCCAGGCAGTGGATGGG + Intronic
1060603586 9:124894949-124894971 GATGGGTCTCTGTTGTGGATGGG - Intronic
1062408232 9:136408225-136408247 GCTGGGTGTGTGCAGTGGAGTGG - Intronic
1188074959 X:25764008-25764030 ACTGAGTATATGCAGGGGATTGG - Intergenic
1190549563 X:51564863-51564885 CCTTGGTATATGCAGGGGATTGG + Intergenic
1196938752 X:120755076-120755098 GATGGGTTTAAGCAGAGGAGTGG + Intergenic
1197362173 X:125518221-125518243 GGTGGGTTTCTGCACTGGATGGG + Intergenic
1198278631 X:135120698-135120720 GGTGGGTATATCCTGTGGCTGGG + Intergenic
1198292330 X:135251818-135251840 GGTGGGTATATCCTGTGGCTGGG - Intronic
1198441898 X:136671697-136671719 GATGGGTTTAGGAAGTGGCTGGG - Intronic
1199342000 X:146691494-146691516 CCTTGGTATATGCAGTTGATTGG + Intergenic