ID: 1150346878

View in Genome Browser
Species Human (GRCh38)
Location 17:64411370-64411392
Sequence GTTGGGTATATGCAGTGGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 1, 2: 1, 3: 15, 4: 162}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150346878 Original CRISPR GTTGGGTATATGCAGTGGAT AGG Intronic
905433469 1:37941256-37941278 ATTGGGTATATGCTATGAATAGG - Intronic
909361381 1:74763095-74763117 GATGGGAATATTCAGTGTATAGG + Intronic
911230212 1:95353182-95353204 GCTTGGTGTATGCAGTGGAGAGG - Intergenic
912067260 1:105758823-105758845 GTGGGTCATTTGCAGTGGATTGG - Intergenic
914050181 1:144124834-144124856 GTTGGGGATCTGGAGTGGAAGGG + Intergenic
914129001 1:144840617-144840639 GTTGGGGATCTGGAGTGGAAGGG - Intergenic
918938295 1:190953628-190953650 GTTGGGAAAATGCAGGGGTTAGG + Intergenic
919932000 1:202227046-202227068 GGTGGGTATTTGCCGTGGAAAGG - Intronic
924000157 1:239541999-239542021 GTGGAGTATAGGCAGTAGATAGG + Intronic
1071777367 10:88804304-88804326 GCTGGGTACACGCAGTGGGTGGG - Intronic
1073639236 10:105233024-105233046 GTTAGTTATATCCAGTTGATTGG + Intronic
1078206284 11:9232709-9232731 GTTGGGTATATGCTCAGGAGTGG - Intronic
1079488551 11:20961827-20961849 CCTGGGTATATGCAGGGAATTGG - Intronic
1085005820 11:73088723-73088745 CTTGGGTATTTGTAGTGGGTAGG - Intronic
1085213568 11:74805939-74805961 GCTCGGTATATGTAGGGGATTGG - Intronic
1086501783 11:87461295-87461317 TTTGGGTATATGCACAGGATTGG - Intergenic
1088091579 11:106046402-106046424 TCTGGGTATATGAAGTAGATAGG + Intergenic
1096368239 12:51046711-51046733 GTTGGGTAGATGGGGTGGACGGG - Intergenic
1097914556 12:65006744-65006766 GTTGTTTGTATGCATTGGATGGG - Intergenic
1100700745 12:97145218-97145240 AATGGGTTGATGCAGTGGATGGG - Intergenic
1101566832 12:105914037-105914059 GTTGGGTTCATGTAGGGGATTGG - Intergenic
1104133521 12:125916837-125916859 GTTGGAAATATGCAGTGAAAAGG + Intergenic
1105975849 13:25471806-25471828 GTTGGGGATGTACAGTGGGTTGG + Intronic
1109043643 13:57378124-57378146 CTTGGGTATATGCATAGGAATGG + Intergenic
1109857187 13:68145957-68145979 GTTGGATATATGCATTGTGTTGG - Intergenic
1116742507 14:48775147-48775169 GTTGGTTATCTGTAGGGGATGGG + Intergenic
1120853020 14:89187750-89187772 GTTGGGTTTATGGGGAGGATGGG + Intronic
1123420060 15:20124173-20124195 GTTGGGGATCTGGAGTGGAAGGG + Intergenic
1123445802 15:20329359-20329381 GTTGGGGATCTGGAGTGGAAGGG - Intergenic
1123529282 15:21130709-21130731 GTTGGGGATCTGGAGTGGAAGGG + Intergenic
1125412329 15:39418289-39418311 GAGGGGTACATGCGGTGGATGGG + Intergenic
1125521645 15:40351151-40351173 GGTGTGTATATGCATTGAATTGG + Intronic
1129785724 15:78308920-78308942 GTCAGGTATGTGCAGAGGATGGG - Intergenic
1130533232 15:84763827-84763849 TGTGGGTATATGTAGTTGATGGG + Intronic
1134906127 16:17981322-17981344 GGTTGGTATACTCAGTGGATGGG - Intergenic
1135356247 16:21771608-21771630 GTTTTGTCTATGCAGTGGGTAGG - Intergenic
1135454738 16:22587747-22587769 GTTTTGTCTATGCAGTGGGTAGG - Intergenic
1140093563 16:71856291-71856313 GCTGGGCATTTGCAGTGGAATGG - Exonic
1147699885 17:42387370-42387392 CTTGGGTAAATGCAGAGGAGAGG - Intronic
1149037471 17:52151259-52151281 ATTGGGCATATGGAGTGGATAGG - Intronic
1149275614 17:55031697-55031719 TTTGGGTATATGCAGGGGTCCGG - Intronic
1150346853 17:64411234-64411256 AGTGGGTATATGTAGTGGATGGG + Intronic
1150346855 17:64411251-64411273 GATGGGCATATGCAGTGAGTGGG + Intronic
1150346860 17:64411268-64411290 AGTGGGTATATGCGGTGGGTGGG + Intronic
1150346863 17:64411285-64411307 GGTGGGCATATGCAGTGGATGGG + Intronic
1150346865 17:64411302-64411324 GATGGGTATATGCAGTGGATAGG + Intronic
1150346876 17:64411353-64411375 GGTGGGCATATGCAGGGGTTGGG + Intronic
1150346878 17:64411370-64411392 GTTGGGTATATGCAGTGGATAGG + Intronic
1150346898 17:64411487-64411509 AGTGGGCACATGCAGTGGATGGG + Intronic
1150346902 17:64411504-64411526 GATGGGCATGTGCAGTGGGTGGG + Intronic
1150346906 17:64411521-64411543 GGTGGGCATATGCAGTGGGTGGG + Intronic
1150346910 17:64411538-64411560 GGTGGGCATGTGCAGTGGGTGGG + Intronic
1150346914 17:64411555-64411577 GGTGGGCATGTGCAGTGGGTGGG + Intronic
1150346918 17:64411572-64411594 GGTGGGCATATGCTGTGGGTGGG + Intronic
1150346921 17:64411589-64411611 GGTGGGCATACGCAGTGGATGGG + Intronic
1150346924 17:64411606-64411628 GATGGGCATGTGCAGTGGATGGG + Intronic
1150346928 17:64411623-64411645 GATGGGCATGTGCAGTGGGTGGG + Intronic
1150346932 17:64411640-64411662 GGTGGGCATACGCAGTGGGTGGG + Intronic
1150346940 17:64411674-64411696 GGTGGGCATGTGCAGTGGGTGGG + Intronic
1150346950 17:64411708-64411730 GGTGGGCATACGCAGTGGGTGGG + Intronic
1150346954 17:64411725-64411747 GGTGGGCATACGCAGTGGGTGGG + Intronic
1150346958 17:64411742-64411764 GGTGGGCATATGCAGTGGGTGGG + Intronic
1150346962 17:64411759-64411781 GGTGGGCATATGCAGTGGGTGGG + Intronic
1150535413 17:66034097-66034119 CCTTGGTATATGCAGGGGATTGG - Intronic
1154388690 18:13918218-13918240 GATGGGTATGTTCAGTAGATTGG - Intergenic
1155048331 18:22124163-22124185 GTTGGGTATATGCCTAGGAGAGG - Intergenic
1156164233 18:34398834-34398856 GTTGGCTGGATGCAGTGGAAAGG + Intergenic
1156663830 18:39381394-39381416 GTTGGGTTTACACAGTAGATGGG + Intergenic
1157119280 18:44893910-44893932 GTTTGGTATATACAATAGATAGG - Intronic
1159590760 18:70332687-70332709 CCTGGGTATCTGCAGGGGATTGG + Intergenic
1160063328 18:75551540-75551562 GTTGGGTGAATACAGTGGAATGG - Intergenic
1160195049 18:76746670-76746692 GTTGGGTAGATGCGGTGAACAGG + Intergenic
1162582072 19:11537636-11537658 GTTGAGGATATGCAGTTTATCGG - Intergenic
1202689587 1_KI270712v1_random:77473-77495 GTTGGGGATCTGGAGTGGAAGGG + Intergenic
926613028 2:14966400-14966422 CTTCAGTATATGCAGAGGATTGG + Intergenic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
929109131 2:38391748-38391770 TTTGGGTATTTGTGGTGGATTGG - Intergenic
929618079 2:43327990-43328012 TTTGGCTATATCCTGTGGATAGG + Intronic
930348844 2:50223342-50223364 GTTGGATAAATGCAGTGGCTGGG - Intronic
931096916 2:58951027-58951049 GTTGGCAATATGCTGTGGAGAGG + Intergenic
931511397 2:62999813-62999835 TTTGGGTATATACCGAGGATTGG + Intronic
932650801 2:73554017-73554039 ATTGGGGATCTGTAGTGGATAGG + Intronic
933956829 2:87378539-87378561 GTTGGGGATCTGGAGTGGAAGGG - Intergenic
934240976 2:90270549-90270571 GTTGGGGATCTGGAGTGGAAGGG - Intergenic
934272219 2:91546212-91546234 GTTGGGGATCTGGAGTGGAAGGG + Intergenic
934905077 2:98193082-98193104 GATGGTTATGAGCAGTGGATAGG + Intronic
936934871 2:117829528-117829550 TTTGGGGCTTTGCAGTGGATTGG + Intronic
939383376 2:141465282-141465304 GTGTGGGATATGCAGTGGCTAGG + Intronic
939434273 2:142153628-142153650 CTTGGGTATATACACTGGAGAGG + Intergenic
940748160 2:157594427-157594449 GTTGGGTATGTGAACAGGATAGG + Intronic
947803406 2:232947310-232947332 GTTGGGTCTACGCACTTGATTGG - Intronic
1169272594 20:4212075-4212097 GTGGGGTATATGCATTGGAGAGG + Intergenic
1174692860 20:52525981-52526003 GTTGGGTTGAAGCAGTGGAAGGG + Intergenic
1175919093 20:62441714-62441736 CTGGGCTATATGCTGTGGATGGG - Intergenic
1178934697 21:36851168-36851190 TTTGGGTATATGCCTAGGATTGG - Intronic
1179254219 21:39700809-39700831 GTTTATCATATGCAGTGGATGGG - Intergenic
1181352177 22:22266859-22266881 GTTGGGGATCTGGAGTGGAAGGG + Intergenic
1182670347 22:31990519-31990541 GTTGGGTAGATGGTGGGGATTGG + Intergenic
952864711 3:37846353-37846375 GTTGGGTTTTTGCAGTAGAATGG + Intergenic
953304737 3:41817709-41817731 CATGGGTATATGCTGTGGTTTGG - Intronic
954814302 3:53268568-53268590 CTTGGGTATATGCACAGGAATGG + Intergenic
955729506 3:61969734-61969756 GTTGGACATATGCAGCTGATAGG - Intronic
956422543 3:69099862-69099884 GTTTTGTATACACAGTGGATTGG + Intronic
964554960 3:157926991-157927013 TTTGGGTATATGCAGAGCAAAGG + Intergenic
965032644 3:163392111-163392133 TTTGGCTATATGCAGTGTAGTGG - Intergenic
971611872 4:28736216-28736238 TTTGGCTATATGCAGGTGATAGG - Intergenic
971801506 4:31298786-31298808 GGTGGGTATCTGCTGTTGATGGG + Intergenic
973379140 4:49307912-49307934 GTTGGGTATATGTGCAGGATGGG + Intergenic
973811929 4:54579874-54579896 GTGGGGTATATGGAGTGAAAGGG + Intergenic
974118827 4:57613236-57613258 GTTATGACTATGCAGTGGATTGG + Intergenic
974220745 4:58967812-58967834 TTTGGGTATTTGCACAGGATTGG + Intergenic
979783365 4:124684272-124684294 GTTGAGTGTATGCAGTGTCTAGG + Intronic
981303712 4:143222296-143222318 CCTTGGTATCTGCAGTGGATTGG + Exonic
982972149 4:162002663-162002685 TTTGGGTCTATGTAGTAGATTGG - Intronic
983221671 4:165049776-165049798 CTTCGGTATCTGCAGAGGATTGG + Intergenic
986165462 5:5268641-5268663 GGTGGATGTATGCAGTGTATGGG - Intronic
992134932 5:73734813-73734835 GTTGTGTTTTTGCAGTGGAGAGG + Intronic
992938312 5:81735388-81735410 TTTTGGTATCTGCAGTGGGTGGG - Intronic
993699336 5:91099565-91099587 GTTGGTTACATGCAGGGGAGTGG + Intronic
994628264 5:102249312-102249334 TTTGGGTATATGCAGGGGTCCGG + Intronic
996048857 5:118909416-118909438 GTTGGGGGTCTGCAGTGGCTTGG - Intronic
998311714 5:141138851-141138873 GTTGGGTATATGCCTAGGAGTGG + Intronic
1002770358 6:285510-285532 GGTGGGTAGGTGCAGTGGATGGG - Intergenic
1003251004 6:4429180-4429202 GTTAGGTATAAGCAAGGGATTGG - Intergenic
1005580061 6:27225317-27225339 TTTGTGTACATGTAGTGGATAGG - Intergenic
1007638976 6:43321099-43321121 CTTCTGTATATGCAGGGGATTGG + Intronic
1008294802 6:49762278-49762300 GCTGGGCATATGCAATGGTTTGG - Intergenic
1009516985 6:64632744-64632766 GTAGGGGATATTCAGTGAATAGG + Intronic
1009552925 6:65122391-65122413 ATTGGGCTTATGCACTGGATTGG + Intronic
1009955924 6:70453333-70453355 GTTGGGTATTTGAAGTGTTTAGG + Intronic
1009972602 6:70640925-70640947 GTTGAGTATAGGCAGTAGAGGGG - Intergenic
1011135192 6:84092635-84092657 TTTCAGTATATGCAGGGGATTGG + Intergenic
1011991974 6:93532877-93532899 GTTGGGTTTATGCAATGTATAGG - Intergenic
1014067163 6:117140781-117140803 ATTGGGTATATTCAGTATATTGG - Intergenic
1014289014 6:119536892-119536914 GTTAGATATCTGCAGTGGGTCGG - Intergenic
1017366999 6:153654941-153654963 CCTGGGTATTTGCAGGGGATTGG - Intergenic
1019103450 6:169650255-169650277 GGTGGGTAGATGGAGGGGATGGG - Intronic
1020776812 7:12464590-12464612 GTTGGGTTTTTGCTGTGGAAAGG - Intergenic
1022495609 7:30851086-30851108 GTGGGTTATATGCAGTAGAATGG - Intronic
1022574988 7:31488847-31488869 GTGGGGTATACCGAGTGGATGGG - Intergenic
1023900668 7:44476043-44476065 GTTGGGTATATGGAGAGAAGGGG + Intronic
1024097378 7:45993634-45993656 TGTGACTATATGCAGTGGATGGG - Intergenic
1026235236 7:68521371-68521393 GTTGAGTATAAGCTGTGGATTGG - Intergenic
1030238894 7:107297403-107297425 CTTGGGTATTTGTAGGGGATTGG - Intronic
1031205313 7:118749520-118749542 GTTGAGTATTTGCAGAGCATGGG - Intergenic
1031543448 7:123024163-123024185 GTTGAGAAAATACAGTGGATGGG - Intergenic
1033958622 7:146884086-146884108 CCTGGGTATATGCAGGGGATGGG + Intronic
1034124537 7:148659311-148659333 CCTTGGTATCTGCAGTGGATGGG - Intergenic
1035824118 8:2626637-2626659 GCTGGGTATATGCAGAGAGTGGG + Intergenic
1036473525 8:9072383-9072405 GTTGCGCATATGCTGTGAATAGG - Intronic
1044954139 8:97462239-97462261 TGTGGGTATATGCTGGGGATTGG - Intergenic
1045672295 8:104568913-104568935 CTTGGGTATATACAGAGGAGTGG - Intronic
1045674634 8:104593585-104593607 CCTTGGTATATGCAGGGGATGGG + Intronic
1049607009 8:143534466-143534488 GTGGGGCATAGGCAGGGGATGGG - Intronic
1050441930 9:5673148-5673170 GTTAGGTATATGCAATGCTTAGG + Intronic
1051552552 9:18346259-18346281 GCTGGCTATATGCAGTGTCTAGG - Intergenic
1057115499 9:92517228-92517250 GTTGGGTATAGCCAGAGGGTTGG + Intronic
1057592629 9:96385456-96385478 GTTGTGTATTTGCAGTGGCAAGG - Intergenic
1058997574 9:110315069-110315091 GATGGGCAAATGCAGGGGATAGG - Intronic
1059024647 9:110612915-110612937 TTTTGGTATATGTAGTGGTTTGG - Intergenic
1059499367 9:114737919-114737941 GTTGGGTCTTTGCAATGGAGAGG - Intergenic
1060350786 9:122857815-122857837 GTTGGATATTTGCAGTGGTTTGG - Intronic
1060364689 9:122999082-122999104 GTAGGGTATTTTCACTGGATAGG + Intronic
1060536144 9:124389660-124389682 GTGGAGTGTCTGCAGTGGATGGG - Intronic
1061504389 9:131023278-131023300 CTTGGGTATATGCTGAGGAGTGG + Intronic
1062408232 9:136408225-136408247 GCTGGGTGTGTGCAGTGGAGTGG - Intronic
1187050380 X:15689821-15689843 TTTGGGTATATGCCCTGAATGGG + Intronic
1187734643 X:22291270-22291292 GTTGAGTATATGCAAAGCATAGG + Intergenic
1188074959 X:25764008-25764030 ACTGAGTATATGCAGGGGATTGG - Intergenic
1189880066 X:45481603-45481625 GTTGAGTATATACATTGGAGTGG - Intergenic
1190549563 X:51564863-51564885 CCTTGGTATATGCAGGGGATTGG + Intergenic
1192244123 X:69359072-69359094 GTGGGTTATAGGCAGTGGTTGGG - Intergenic
1192577296 X:72253230-72253252 CTTGGGTAGTTGCAGTGGAGTGG - Intronic
1193495994 X:82213607-82213629 TTTGGGTATATGCACAGTATTGG + Intergenic
1193813311 X:86077121-86077143 GTTTGGTATATGAATTGGCTGGG - Intergenic
1197362173 X:125518221-125518243 GGTGGGTTTCTGCACTGGATGGG + Intergenic
1197673621 X:129306322-129306344 GTTGGGTATATGCATAGTAATGG + Intergenic
1198278631 X:135120698-135120720 GGTGGGTATATCCTGTGGCTGGG + Intergenic
1198292330 X:135251818-135251840 GGTGGGTATATCCTGTGGCTGGG - Intronic
1199342000 X:146691494-146691516 CCTTGGTATATGCAGTTGATTGG + Intergenic