ID: 1150346924

View in Genome Browser
Species Human (GRCh38)
Location 17:64411606-64411628
Sequence GATGGGCATGTGCAGTGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 2, 2: 7, 3: 27, 4: 240}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150346924 Original CRISPR GATGGGCATGTGCAGTGGAT GGG Intronic
900754523 1:4424481-4424503 GCTGGGCATGTACACTGGAGTGG + Intergenic
902407287 1:16191702-16191724 GAAGGGCATGGGCACTGGGTGGG + Intergenic
902982585 1:20136429-20136451 GATGGGCATGCGCAGAGGAAAGG + Intergenic
904593805 1:31630349-31630371 GATGGCCATGAGCAGTTGAGTGG - Exonic
905830243 1:41059780-41059802 GATGGGCAAGTGCAGGAGCTAGG - Intronic
906687909 1:47774338-47774360 GCTGGGCCAGTGCAGTGGGTAGG + Intronic
907236082 1:53049179-53049201 GCATGGCATGTGCAGTGGGTGGG - Intronic
907413054 1:54295771-54295793 GAAGGGCATGTGCAAAGGCTGGG - Intronic
909361381 1:74763095-74763117 GATGGGAATATTCAGTGTATAGG + Intronic
909837652 1:80276876-80276898 GATGGGCAGGTGCAGGAGCTGGG - Intergenic
910032906 1:82753078-82753100 GAGGTGCATGTACAGTCGATGGG - Intergenic
910907042 1:92192263-92192285 GATGGGCAGGTGCAGAGGTCGGG + Intergenic
912067260 1:105758823-105758845 GTGGGTCATTTGCAGTGGATTGG - Intergenic
912958514 1:114173975-114173997 GGTGGGCATGAGCAGAGGAATGG + Intergenic
913243360 1:116850081-116850103 GAAGAGCATGTACAGTGGAAAGG - Intergenic
913454765 1:119019585-119019607 GATGGGCATGTGCAGGGCCCAGG - Intergenic
915553373 1:156647682-156647704 GGTGGGCAGGGGCTGTGGATTGG + Exonic
916243145 1:162659445-162659467 GCTGGGCATGTGGAGTGGAGGGG + Intronic
916434520 1:164765313-164765335 CATGTACATGTGCAGTGGAGTGG + Intronic
916579590 1:166095523-166095545 GCTGGGCATGGGCAGGGGAAGGG + Intronic
916786745 1:168092175-168092197 GATGGGCATGTGCAGGGGAAAGG - Intronic
917523699 1:175768732-175768754 GGAGGGCATCTGCAGGGGATGGG + Intergenic
917539956 1:175902462-175902484 GATGGGCAAGTGCAGGAGCTGGG - Intergenic
917972280 1:180216504-180216526 CTTGGGCCTGAGCAGTGGATTGG + Intergenic
918974369 1:191462917-191462939 GCTAGCCATGTGCAGAGGATTGG + Intergenic
921661927 1:217813325-217813347 GATGTGCAAGTGCAGTGTGTGGG + Intronic
921663014 1:217829739-217829761 CATGGGCATGGGGAGGGGATTGG + Intronic
922749010 1:228062138-228062160 GATGGGCATGGGGACTGGACAGG - Intergenic
1063347975 10:5328814-5328836 GAGGTGCATGTGCAGAGGAAAGG + Intergenic
1064755970 10:18572146-18572168 GAAGGGAATGTGGAGTGGAATGG - Intronic
1068907106 10:62338798-62338820 GATGGGCAGGTGCAGGAGCTGGG - Intergenic
1069255316 10:66324586-66324608 GATGGGCAGGTGCAGAGGCTGGG - Intronic
1069834162 10:71298100-71298122 GATGGGGATGGGCTGTGGTTTGG - Intronic
1069937396 10:71927217-71927239 GAGAGGCATATGCAGTGGAAGGG + Intergenic
1069942758 10:71966151-71966173 GCTGGGCATGTGCTGGGGGTAGG + Intronic
1070368581 10:75760103-75760125 CATGGGAAAGTGCAGTGCATGGG + Intronic
1070413416 10:76166037-76166059 GATGGGCATTTGTAGCGGTTAGG + Intronic
1070855210 10:79603121-79603143 GATGGGCAGGTTCAGAGGCTGGG + Intergenic
1071298392 10:84238940-84238962 GAAGGGCCTGTTCAGTGGCTGGG - Intronic
1073138355 10:101231822-101231844 GATGGGCAACAGCAGGGGATTGG - Intergenic
1073449422 10:103600876-103600898 GAAGGGGATGGGTAGTGGATGGG - Exonic
1073481207 10:103787219-103787241 CATGGGCCTGTGCCCTGGATGGG - Intronic
1074164474 10:110862856-110862878 GGTGGCCATGTGCATTTGATGGG - Intergenic
1076220145 10:128727350-128727372 GGTGGGCATTTGCATTGGAAAGG - Intergenic
1076357866 10:129865955-129865977 GACCTGCATGTGCAGTGGCTGGG - Intronic
1078639204 11:13079621-13079643 CATGGGGATCTGCAGTGGAGAGG - Intergenic
1079095967 11:17510271-17510293 GGTGGGCCTGGACAGTGGATGGG + Intronic
1079849642 11:25515670-25515692 GATGGGCAAGTGCAGAGGCCCGG + Intergenic
1079894886 11:26105939-26105961 GGTGCCCATGAGCAGTGGATTGG - Intergenic
1080407751 11:31994838-31994860 GGTGGGCCTGTGTAGTGGACAGG - Intronic
1081462782 11:43287019-43287041 GATGGGCAGGTGCAGAGGCCAGG - Intergenic
1083246106 11:61429617-61429639 GCTAGGCAGGTGCAGCGGATAGG - Intronic
1085741143 11:79079376-79079398 GCTGGGCATGTGCAGGGCCTAGG + Intronic
1090745947 11:129704911-129704933 GAGAGGCAGGTGCAGAGGATGGG + Intergenic
1094082106 12:26548355-26548377 GATGGGGGTGTGAAGTGGAGAGG + Intronic
1095051613 12:37559593-37559615 GATGCCCATCAGCAGTGGATTGG - Intergenic
1095748155 12:45682441-45682463 GATGGGCAGGTGCAGGAGCTGGG - Intergenic
1096226559 12:49869989-49870011 GCTGGGCAGGTGGAGTGGGTGGG - Exonic
1102236228 12:111296255-111296277 GAGAGGGATGTGCAGTGGCTGGG - Intronic
1103166208 12:118772789-118772811 GATGGGCAGGTGGAGAGGCTGGG + Intergenic
1103876436 12:124131082-124131104 CATGGGTATGTGTAATGGATTGG - Intronic
1103945959 12:124526575-124526597 GCTGGGCATGGACAGAGGATGGG - Intronic
1104096760 12:125565326-125565348 GATGGGCAGGTGCAGGAGCTGGG + Intronic
1104211383 12:126691972-126691994 TATGGGCATTGTCAGTGGATAGG - Intergenic
1105975849 13:25471806-25471828 GTTGGGGATGTACAGTGGGTTGG + Intronic
1106692463 13:32133027-32133049 GCTGGGGATGGGGAGTGGATAGG + Intronic
1106823358 13:33490921-33490943 GATGGGCAGGTGCAGAGGCCAGG - Intergenic
1107974956 13:45679938-45679960 GATGGGCAGGTGCAGAGGCTGGG + Intergenic
1107986651 13:45781946-45781968 CATGGGAATGTGCTGGGGATGGG + Exonic
1108104797 13:46997554-46997576 GATGGGCAGGTGCAGGAGCTGGG + Intergenic
1108982598 13:56537571-56537593 GATGCCCATCAGCAGTGGATTGG - Intergenic
1109179967 13:59202071-59202093 GAAGGGCATGTGCAGTGGAGGGG - Intergenic
1109189833 13:59310714-59310736 GATGTGCATGTCAAGTGAATTGG - Intergenic
1109378491 13:61526421-61526443 GATGGGCAGGTGCAGAGGGTGGG + Intergenic
1109801192 13:67380522-67380544 GATGGGCAGGTGCAGAGGCTGGG - Intergenic
1111073449 13:83200354-83200376 GATAGGCAGGTGCAGAGGCTGGG - Intergenic
1111251878 13:85612606-85612628 GATGAGCAGGTGCAGTAGCTAGG + Intergenic
1111366024 13:87246056-87246078 GATAGGCATGTGCTATGGTTTGG - Intergenic
1111610692 13:90603216-90603238 GATGGGCAGGTGCAGGGGCCAGG + Intergenic
1114383072 14:22229238-22229260 GATGGGAATGTGCAGTTGGAAGG + Intergenic
1116029749 14:39556565-39556587 GATGAGCAAATGCAGTGGAGTGG + Intergenic
1117733508 14:58747131-58747153 GATGGGGATGAGCAGTGGGGAGG + Intergenic
1117733523 14:58747190-58747212 GATGGGGATGAGCAGTGGGGAGG + Intergenic
1118042373 14:61931091-61931113 GATCTGCATGTGCATTGGAATGG - Intergenic
1119542803 14:75451668-75451690 GATGGGCAGGTGCAGGGGAGTGG + Intronic
1120415596 14:84215080-84215102 GATGGGCAGGTGCAGAGGCTGGG + Intergenic
1121027080 14:90624479-90624501 GAGGTGCATGTCCAGTGGTTGGG - Intronic
1121060395 14:90902778-90902800 AATGTGCATGTGCACAGGATGGG + Intronic
1121631304 14:95423546-95423568 GATGGGCATGGGGATTTGATGGG + Intronic
1125602073 15:40920976-40920998 GATGTGCATGTGCAGAGTTTGGG - Intergenic
1130087175 15:80787395-80787417 GATGGGCATTTGCAGTTGCCTGG + Intronic
1130239948 15:82178749-82178771 GAGGGGCATGTCCAGAGAATTGG - Intronic
1130328273 15:82899219-82899241 GATGGGCACATGCATTGGCTGGG - Intronic
1130842645 15:87715921-87715943 GATGGGCATGTGCAGAGTTCTGG + Intergenic
1130845155 15:87737121-87737143 GATGGCCATGTGCAAAGGCTCGG - Intergenic
1132081987 15:98874085-98874107 TATGGGCATGTGATGTGGACAGG + Intronic
1132255296 15:100371831-100371853 GATGCCCATCAGCAGTGGATTGG - Intergenic
1139363203 16:66416276-66416298 GACAGGGATGGGCAGTGGATGGG - Intergenic
1140093563 16:71856291-71856313 GCTGGGCATTTGCAGTGGAATGG - Exonic
1141731462 16:85825615-85825637 GATGGGCATGTGATGTATATGGG + Intergenic
1142666752 17:1467771-1467793 GATGGGGAGGTGGGGTGGATGGG - Intronic
1143522826 17:7455195-7455217 AATGGGCATGTGGAGTGGGGTGG + Intronic
1143646910 17:8236121-8236143 GCTGGGCATGGGGAGTGGCTTGG + Exonic
1144090272 17:11850150-11850172 GCTGGGCATCTGGAGAGGATGGG + Intronic
1144641287 17:16938585-16938607 TGTGGGGATGTGCAGTGGACAGG - Intronic
1144750848 17:17647123-17647145 GAAGGGGATGTGCAGGGGAGGGG + Intergenic
1149037471 17:52151259-52151281 ATTGGGCATATGGAGTGGATAGG - Intronic
1150346855 17:64411251-64411273 GATGGGCATATGCAGTGAGTGGG + Intronic
1150346863 17:64411285-64411307 GGTGGGCATATGCAGTGGATGGG + Intronic
1150346865 17:64411302-64411324 GATGGGTATATGCAGTGGATAGG + Intronic
1150346876 17:64411353-64411375 GGTGGGCATATGCAGGGGTTGGG + Intronic
1150346878 17:64411370-64411392 GTTGGGTATATGCAGTGGATAGG + Intronic
1150346898 17:64411487-64411509 AGTGGGCACATGCAGTGGATGGG + Intronic
1150346902 17:64411504-64411526 GATGGGCATGTGCAGTGGGTGGG + Intronic
1150346906 17:64411521-64411543 GGTGGGCATATGCAGTGGGTGGG + Intronic
1150346910 17:64411538-64411560 GGTGGGCATGTGCAGTGGGTGGG + Intronic
1150346914 17:64411555-64411577 GGTGGGCATGTGCAGTGGGTGGG + Intronic
1150346918 17:64411572-64411594 GGTGGGCATATGCTGTGGGTGGG + Intronic
1150346921 17:64411589-64411611 GGTGGGCATACGCAGTGGATGGG + Intronic
1150346924 17:64411606-64411628 GATGGGCATGTGCAGTGGATGGG + Intronic
1150346928 17:64411623-64411645 GATGGGCATGTGCAGTGGGTGGG + Intronic
1150346932 17:64411640-64411662 GGTGGGCATACGCAGTGGGTGGG + Intronic
1150346940 17:64411674-64411696 GGTGGGCATGTGCAGTGGGTGGG + Intronic
1150346946 17:64411691-64411713 GGTGGGCATGTGCAGGGGGTGGG + Intronic
1150346950 17:64411708-64411730 GGTGGGCATACGCAGTGGGTGGG + Intronic
1150346954 17:64411725-64411747 GGTGGGCATACGCAGTGGGTGGG + Intronic
1150346958 17:64411742-64411764 GGTGGGCATATGCAGTGGGTGGG + Intronic
1150346962 17:64411759-64411781 GGTGGGCATATGCAGTGGGTGGG + Intronic
1150450506 17:65263126-65263148 GATGCCCATCAGCAGTGGATTGG + Intergenic
1152139764 17:78529599-78529621 GATGGGCTTGTGGAGGTGATGGG - Exonic
1152709589 17:81864421-81864443 GATGGAAATGTGCAGGGCATGGG + Intergenic
1154388690 18:13918218-13918240 GATGGGTATGTTCAGTAGATTGG - Intergenic
1155021552 18:21901414-21901436 AATGGGGATGTGCACTGGATGGG - Intergenic
1157225486 18:45859375-45859397 GGTGGGCATGTGCTGTTCATGGG + Intronic
1157716904 18:49894194-49894216 AATGGGGAGTTGCAGTGGATGGG - Intronic
1157855452 18:51100770-51100792 GATGGGCAGGTGCAGAGGCTGGG - Intergenic
1158080260 18:53581892-53581914 GAGGGGAAAGTGCAGTGGATAGG + Intergenic
1160261828 18:77301277-77301299 GATGGGCACGTGCTGGGGAGTGG + Intergenic
1160423690 18:78766589-78766611 GATGCCCAGGTGCAGTGCATGGG + Intergenic
1160833372 19:1113480-1113502 GCGGGGCATGGGCAGTGGGTGGG - Intronic
1161535913 19:4818358-4818380 GATGGGCCTGTGCAGGCCATGGG + Exonic
1164983339 19:32630434-32630456 TATGGGCGTGTGCACTGGGTTGG - Intronic
1165120725 19:33556800-33556822 GCTGGGGAGGTGCAGTGGTTTGG - Intergenic
1166910610 19:46153282-46153304 GATGGGCATTTCCCGTGTATGGG + Intronic
1167706446 19:51083983-51084005 GATGGGCACCTACAGGGGATGGG + Intronic
1168127374 19:54293211-54293233 GATAGGCATTTGCAGTGTGTTGG - Intergenic
1168172983 19:54601637-54601659 GATAGGCATTTGCAGTGTGTTGG + Intronic
925055412 2:853436-853458 AAAGGGAATGTGCAGTGGAGGGG + Intergenic
926394111 2:12423841-12423863 GATGGGCAGATGCAGAGGCTGGG - Intergenic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
928245455 2:29622728-29622750 GAAGAGCATGTGCAGAGGAGGGG - Intronic
928827596 2:35440229-35440251 GAAGGTAATGTGGAGTGGATAGG + Intergenic
930732649 2:54743254-54743276 GATGTGCATGTTCAGTGAACTGG - Intronic
931795010 2:65700529-65700551 GAAGGGCCTGTGCATTGCATGGG - Intergenic
931874902 2:66501840-66501862 AATGTGAATGTGCATTGGATGGG - Intronic
933425993 2:82112776-82112798 GATGGGCAGGTGCAGGAGCTGGG - Intergenic
934905077 2:98193082-98193104 GATGGTTATGAGCAGTGGATAGG + Intronic
934985650 2:98882990-98883012 ACTGGGCACGTGCAGGGGATGGG - Intronic
936385140 2:112022505-112022527 GGTGGGCATGTGCAGAGGGGTGG + Intronic
940864674 2:158806065-158806087 GCAGGGCATGTGCACAGGATAGG + Intronic
940965937 2:159837241-159837263 GATGTCCATCAGCAGTGGATTGG + Intronic
942184663 2:173413695-173413717 TATGAGCATGTTCAGGGGATGGG - Intergenic
942894567 2:181036530-181036552 GATGTGCATGTTAAGTGAATTGG + Intronic
944254776 2:197614648-197614670 GATGGGCAGGTGCAGGAGCTGGG - Intronic
947119722 2:226801180-226801202 GCTGGGCATGCTCAGTGGCTGGG + Intergenic
947129223 2:226904308-226904330 GATGGGCAGGTGCAGGAGCTGGG - Intronic
948329675 2:237155185-237155207 GATGGGCATGTCAAGAGGCTGGG - Intergenic
1170163824 20:13342831-13342853 GATGGGGGTGTGTAGAGGATGGG + Intergenic
1170907393 20:20528429-20528451 GATGGACTTGGGCAGTGGGTGGG + Intronic
1171356456 20:24549531-24549553 GAAGGGCAGGTGCAGAGGCTGGG + Intronic
1171546149 20:26003139-26003161 GATGCCCATCAGCAGTGGATTGG - Intergenic
1172379587 20:34477159-34477181 GATGGGCATGGTCAGAGGTTGGG - Intronic
1172591019 20:36117919-36117941 GATTGGCAAGAGCAGTGGATTGG - Intronic
1173638864 20:44584996-44585018 CATGGGCATGGGCAGTGGGAAGG + Intronic
1173741343 20:45404878-45404900 GAAGGGCATGTGCAGAGGGAGGG - Intronic
1175571277 20:60024655-60024677 GATGAGCATGTTCTGTGTATGGG + Intronic
1179356653 21:40666250-40666272 GCTGGGCATGCACAGTGCATGGG - Intronic
1180917169 22:19497330-19497352 GAGGGGCATGTGCTGGGGCTGGG - Intronic
1180969030 22:19805369-19805391 GATGGGCCTGTGCAGTTTGTGGG - Intronic
1181037615 22:20177486-20177508 GGTGGGCGAGTGCAGTGGGTGGG + Intergenic
1182771534 22:32800370-32800392 GATGGGAAGGAGCAGTGGAAAGG + Intronic
1184744310 22:46447464-46447486 GATGGGGGTGTGCAGAGTATGGG - Intronic
949577795 3:5355675-5355697 GCTGTGCATGTGCAGAGGCTAGG + Intergenic
950947175 3:16961261-16961283 TATGGAAATGTGCAGTGGAAAGG - Intronic
953771117 3:45779295-45779317 AATGAGCATGAGCAGTGGAAAGG + Intronic
954627177 3:52028914-52028936 GGTGGGGGTGTGCAGGGGATGGG + Intergenic
955554923 3:60126672-60126694 TATGAGCGTGTGCTGTGGATTGG - Intronic
956181094 3:66518842-66518864 GATGGGCAGGTACAGAGGCTGGG + Intergenic
956689331 3:71861383-71861405 GATGGGCAGGTGCAGGAGCTGGG - Intergenic
961004412 3:123395309-123395331 GATGGGCATGTTTAGGGGAGAGG - Intronic
962522932 3:136213734-136213756 CATGGGACTGTGCAGTGGAGTGG - Intergenic
963102898 3:141623010-141623032 GATGGGCAGGTGCAGGAGCTGGG - Intergenic
963267654 3:143254997-143255019 GATGGGCATGTGCTGTAGGCTGG + Intergenic
968524920 4:1051714-1051736 GATGGGCAGGTGATGTGGTTTGG + Intergenic
970450504 4:16162213-16162235 GGTGGGCCTGTGCTGGGGATGGG - Exonic
971294966 4:25379810-25379832 GAGGAGCATGTGCAGTGGTGAGG + Intronic
972228951 4:37048125-37048147 GATGAGCATGTTCAGAGTATTGG - Intergenic
974962779 4:68724547-68724569 GATGGGCAGGTGCAGAGGCCAGG + Intergenic
975247583 4:72138059-72138081 GATGTGCAAGATCAGTGGATTGG + Exonic
977430156 4:96921722-96921744 GATGCCCATGAGCAGTGGAGTGG - Intergenic
977551055 4:98444269-98444291 GATGTGCCATTGCAGTGGATGGG + Intergenic
979802357 4:124926912-124926934 GATGGGCAGGTACAGAGGCTAGG + Intergenic
980717996 4:136653229-136653251 AATGGGCAGCTGGAGTGGATTGG + Intergenic
980871508 4:138616026-138616048 GATGGGCAGGTGCAGGAGCTGGG - Intergenic
981447489 4:144856859-144856881 GGTGGCCATCAGCAGTGGATTGG + Intergenic
981582700 4:146266393-146266415 CATGGGCATGTGTGGTGGGTAGG - Intronic
986083163 5:4414977-4414999 TATGGGCATTTGCATTGGAATGG + Intergenic
987504783 5:18754049-18754071 GATGGGCAGGTGCAGGAGCTGGG + Intergenic
987608274 5:20167669-20167691 CATGTGAATGTGCAGTGAATAGG + Intronic
989969843 5:50510325-50510347 GATGTGCATGTTCAGTTAATTGG + Intergenic
990895663 5:60698251-60698273 GAGGTGCATGTGGAGAGGATGGG - Intronic
991549939 5:67824835-67824857 GATGGGCATGTTGGGTGAATTGG - Intergenic
992160049 5:73992387-73992409 GATGGGCAGGTGCAGGAGCTGGG + Intergenic
992226041 5:74620507-74620529 GATGGGCAGGTGCAGCAGCTGGG + Intergenic
992994383 5:82318116-82318138 GATGAGCATGTGCAGGGCATAGG - Exonic
993882069 5:93374749-93374771 GATGGCCATCAACAGTGGATTGG + Intergenic
996134346 5:119820583-119820605 CATGAGCAGGTGCATTGGATGGG + Intergenic
996852236 5:127966214-127966236 GATGGGCAAGTGCAGAGGCCGGG + Intergenic
998158536 5:139799867-139799889 GATGAGCTTGTGCAATGGCTTGG + Intronic
998398203 5:141833267-141833289 GATGGGCATGTGCACTGGTGGGG + Intergenic
999750390 5:154624162-154624184 GGTGGGAATGTGCACTGGGTGGG + Intergenic
1000635126 5:163635264-163635286 AATGGGCCTATGCAGTGGTTGGG + Intergenic
1002770358 6:285510-285532 GGTGGGTAGGTGCAGTGGATGGG - Intergenic
1003036731 6:2646504-2646526 GATGTGCATGTGTAGTGGGAGGG + Intergenic
1004469496 6:15916695-15916717 GATGGGCAGGTGCAGGAGCTGGG + Intergenic
1007702794 6:43774295-43774317 CATGGGCATGGGCAGGGGCTGGG - Intronic
1007960141 6:45951452-45951474 GAAGGCCAAGTGCAGTGGAAAGG + Intronic
1008294802 6:49762278-49762300 GCTGGGCATATGCAATGGTTTGG - Intergenic
1009468471 6:64002562-64002584 GATGGGCAGGTACAGAGGCTAGG - Intronic
1010503736 6:76631777-76631799 GATGGGCAGGTGCAGAGGCCTGG + Intergenic
1011128522 6:84032116-84032138 GATGGGCATTTGGAGTGAACAGG - Intergenic
1014638320 6:123877459-123877481 GATGGGCATATGGAATGTATGGG + Intronic
1015506852 6:133997406-133997428 GGTGTCCATGAGCAGTGGATTGG + Intronic
1017948551 6:159116488-159116510 GATGGGCAGGTGCAGAGGCCAGG - Intergenic
1018103913 6:160465377-160465399 GATTGGCATCTGCAGTGGGGCGG + Intergenic
1018131005 6:160732566-160732588 GATTGGCATCTGCAGTGGGGCGG - Intronic
1022569484 7:31437640-31437662 GATGGGTATGTGGAATGAATGGG - Intergenic
1023442689 7:40200671-40200693 GATGGGTCTGAGCAGTGGAGGGG + Intronic
1030093650 7:105878368-105878390 GACTGGCCTGTGCAGTGGGTGGG + Intronic
1032228692 7:130055138-130055160 AATGGAAATGTGCAGTGGAGGGG - Intergenic
1032781529 7:135168435-135168457 GATGGGCAAGATCAGTGGAAGGG - Intronic
1034269752 7:149797786-149797808 GGTGGACATGTGCATTGGGTGGG + Intergenic
1035737252 8:1897937-1897959 GAGGGGGCTGTGCAGTGGAGAGG - Intronic
1037818290 8:22123528-22123550 GCTGGGGCTGTGCAGTGGGTAGG + Intronic
1038428674 8:27482405-27482427 GATGGACATGTGCCATTGATAGG + Intergenic
1040091538 8:43403656-43403678 GAGGGCCAGGTGCAGTGGCTCGG - Intergenic
1041295173 8:56349396-56349418 GATGGCCATCTGTGGTGGATTGG - Intergenic
1049469123 8:142767546-142767568 CGTGGGCATGTGTAGTGGACAGG - Intronic
1050137577 9:2483158-2483180 GAAGGGCATGTGCAGGGTATAGG + Intergenic
1050934630 9:11379904-11379926 GATGGGCAGTTGCAGAGGCTGGG + Intergenic
1051220462 9:14843296-14843318 GATGGGCAAGGGGAGTGGAGAGG - Intronic
1051263530 9:15288817-15288839 GATGGGCAGGTGCAGAAGCTGGG - Intronic
1053798655 9:41749032-41749054 GATGCCCATCAGCAGTGGATTGG + Intergenic
1054146548 9:61565929-61565951 GATGCCCATCAGCAGTGGATTGG - Intergenic
1054187070 9:61961077-61961099 GATGCCCATCAGCAGTGGATTGG + Intergenic
1054466283 9:65496997-65497019 GATGCCCATCAGCAGTGGATTGG - Intergenic
1054651438 9:67627445-67627467 GATGCCCATCAGCAGTGGATTGG - Intergenic
1055078142 9:72238107-72238129 GATGAGGCTGGGCAGTGGATGGG - Intronic
1055203804 9:73701578-73701600 TATTGGCATGTCCTGTGGATAGG - Intergenic
1055373333 9:75624031-75624053 GATGAGCATGGGGAGTGGGTGGG + Intergenic
1056301735 9:85249326-85249348 GATGGGCAGGTGCAGAGGCCAGG + Intergenic
1058997574 9:110315069-110315091 GATGGGCAAATGCAGGGGATAGG - Intronic
1059505882 9:114799596-114799618 GCTGGGGATGTGAAGTGGGTGGG - Intronic
1061121370 9:128644743-128644765 GATAGGCTTGTGCAGTGCAGGGG - Intronic
1062408232 9:136408225-136408247 GCTGGGTGTGTGCAGTGGAGTGG - Intronic
1062663921 9:137656590-137656612 GCTGGGCCTGTGCTGTGGACTGG + Intronic
1188183712 X:27088376-27088398 GATGCGCAGGTGCAGAGGCTGGG + Intergenic
1188496350 X:30787181-30787203 GACGGGCAGGTGCAGAGGACAGG + Intergenic
1189687954 X:43585759-43585781 GCTGTGCATGTGAAGTGAATTGG - Intergenic
1190414697 X:50169439-50169461 GATGGGCGTGGGCTGTGGTTGGG + Intergenic
1192001296 X:67154696-67154718 GATGGGCAGGTGCAGAGGCCAGG + Intergenic
1196593215 X:117513216-117513238 TATTGGCATGTGCAGTGAAGAGG - Intergenic
1198387820 X:136146346-136146368 CATGGGCAGGTGCAGTCCATGGG - Intergenic
1199272758 X:145904366-145904388 TATGGGCATGTGAAGTGCACAGG + Intergenic
1199985660 X:152948278-152948300 GATAAGCAGGTGCAGTTGATGGG + Intronic
1200472383 Y:3600828-3600850 GTTGGGCAGGTGCAGAGGCTGGG - Intergenic
1201725927 Y:17152219-17152241 GATGGGCAGGTGCAGGAGCTGGG + Intergenic