ID: 1150348093

View in Genome Browser
Species Human (GRCh38)
Location 17:64420229-64420251
Sequence GGTGCTGATGCCCCACAATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150348086_1150348093 27 Left 1150348086 17:64420179-64420201 CCAGCAAACTCAGAGAAGCAGGA No data
Right 1150348093 17:64420229-64420251 GGTGCTGATGCCCCACAATTGGG No data
1150348084_1150348093 28 Left 1150348084 17:64420178-64420200 CCCAGCAAACTCAGAGAAGCAGG No data
Right 1150348093 17:64420229-64420251 GGTGCTGATGCCCCACAATTGGG No data
1150348088_1150348093 0 Left 1150348088 17:64420206-64420228 CCATTCATAGGATGTTGTTCCTG No data
Right 1150348093 17:64420229-64420251 GGTGCTGATGCCCCACAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150348093 Original CRISPR GGTGCTGATGCCCCACAATT GGG Intergenic
No off target data available for this crispr