ID: 1150351280

View in Genome Browser
Species Human (GRCh38)
Location 17:64446800-64446822
Sequence CTATATGAAAATGTGGAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150351276_1150351280 -9 Left 1150351276 17:64446786-64446808 CCATTTCCATGGGTCTATATGAA No data
Right 1150351280 17:64446800-64446822 CTATATGAAAATGTGGAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150351280 Original CRISPR CTATATGAAAATGTGGAGCC GGG Intergenic
No off target data available for this crispr