ID: 1150352828

View in Genome Browser
Species Human (GRCh38)
Location 17:64458924-64458946
Sequence GTGTTTGCACATGTGGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 318}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150352814_1150352828 20 Left 1150352814 17:64458881-64458903 CCTGAACCTGAGCCAAGGGAGCT 0: 1
1: 0
2: 0
3: 14
4: 152
Right 1150352828 17:64458924-64458946 GTGTTTGCACATGTGGGCTGGGG 0: 1
1: 0
2: 2
3: 38
4: 318
1150352815_1150352828 14 Left 1150352815 17:64458887-64458909 CCTGAGCCAAGGGAGCTGTTTAT 0: 1
1: 0
2: 1
3: 8
4: 138
Right 1150352828 17:64458924-64458946 GTGTTTGCACATGTGGGCTGGGG 0: 1
1: 0
2: 2
3: 38
4: 318
1150352813_1150352828 21 Left 1150352813 17:64458880-64458902 CCCTGAACCTGAGCCAAGGGAGC 0: 1
1: 0
2: 0
3: 19
4: 168
Right 1150352828 17:64458924-64458946 GTGTTTGCACATGTGGGCTGGGG 0: 1
1: 0
2: 2
3: 38
4: 318
1150352820_1150352828 8 Left 1150352820 17:64458893-64458915 CCAAGGGAGCTGTTTATGGGGGG 0: 1
1: 0
2: 2
3: 6
4: 107
Right 1150352828 17:64458924-64458946 GTGTTTGCACATGTGGGCTGGGG 0: 1
1: 0
2: 2
3: 38
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150352828 Original CRISPR GTGTTTGCACATGTGGGCTG GGG Intronic
900137400 1:1123781-1123803 GTGTGTGCAGATGTGTGCTCAGG - Intergenic
900137403 1:1123827-1123849 GTGTTTGCAGATACGTGCTGAGG - Intergenic
900215478 1:1479381-1479403 GTGTGTGCCCATGTGTGCAGGGG - Intronic
900478710 1:2888098-2888120 GTGCGTGCACACGTGGGATGGGG - Intergenic
901339159 1:8479635-8479657 CTGTTTGCACATTTTGGCTGTGG - Intronic
901828545 1:11878551-11878573 GTGACTGCCCATGTGGGCTGAGG - Intergenic
902596285 1:17511744-17511766 TTGTTTGCAAAAGTGGGATGAGG + Intergenic
902782820 1:18715798-18715820 CTGTTTGCAGATGGGGTCTGAGG + Intronic
902806354 1:18863559-18863581 GTGTTGGGACGTGTGGGCTCTGG + Intronic
903462494 1:23529621-23529643 GTGTGTGCACAGGGTGGCTGTGG - Intronic
904367932 1:30028543-30028565 GTGCTGCCACATGTGAGCTGGGG - Intergenic
904410915 1:30324419-30324441 GTGTTTCCACTGATGGGCTGTGG + Intergenic
904962081 1:34341290-34341312 GTGTTTTAACATGAGGGCGGAGG - Intergenic
905286409 1:36883414-36883436 GTGTTTGGACATAAGGGCTGGGG - Intronic
905521909 1:38606998-38607020 GTGTGTGCAGCTGAGGGCTGTGG - Intergenic
905559465 1:38915065-38915087 GAGTTAGCACTAGTGGGCTGAGG + Intronic
905658348 1:39700955-39700977 GTGATTGAACTTGTGGGCTCTGG + Intronic
906522759 1:46477111-46477133 GTGAGGGCACAGGTGGGCTGGGG - Intergenic
907184952 1:52602436-52602458 GTGGCTGCTCCTGTGGGCTGCGG + Exonic
907525844 1:55053572-55053594 GTGTTTGACCCTGGGGGCTGGGG - Intronic
909318311 1:74251665-74251687 GTGTGTGCACGTGTGGGAGGAGG + Intronic
910499416 1:87872396-87872418 GTGTTTCCACATGTGGGAGTTGG - Intergenic
910765663 1:90779847-90779869 GCGTTAGCCCCTGTGGGCTGAGG - Intergenic
910838539 1:91539471-91539493 GTATTTGCAGGTGTGGGCTCTGG + Intergenic
913216319 1:116623742-116623764 GTCCTTGCACCTGTGGGCTTGGG - Intronic
913497312 1:119440200-119440222 GTGTATCTACATGTGGGCTCTGG + Intergenic
913504992 1:119508720-119508742 GTGTGTCTACATGTGGGCTCTGG + Intronic
913508364 1:119539996-119540018 GTGTGTCTACATGTGGGCTCTGG + Intergenic
913511321 1:119565243-119565265 GTGTGTCTACATGTGGGCTCTGG + Intergenic
915593553 1:156883911-156883933 GTGTTTGCACATGTGTGTCTAGG - Intergenic
916105310 1:161425629-161425651 GTGCTTGCACATGTGGTTTCTGG - Intergenic
919144770 1:193620265-193620287 GTGGTTGGACATGTGGGCTCTGG + Intergenic
919981533 1:202645062-202645084 GTGTGTTCATGTGTGGGCTGGGG + Intronic
920440029 1:205974340-205974362 GTGTTTGCATGTGTGGTGTGTGG - Intergenic
921568609 1:216751491-216751513 GGGTTTGCACAGCTGGGCTGAGG - Intronic
921600502 1:217101658-217101680 GTGTTTGCTGATGTGGGAGGTGG - Intronic
923377949 1:233384711-233384733 GTGTTTGCATGTGTGTGTTGGGG + Exonic
1062970788 10:1646739-1646761 TTGTTTTCACATGTGGGAGGGGG + Intronic
1063691758 10:8294547-8294569 GTGTTTAGAAATGTGGGCTTGGG + Intergenic
1064283424 10:13971061-13971083 GTGTGTGCACCTGTGTGTTGGGG - Intronic
1064563210 10:16613093-16613115 GTGTTTGCAAGTGAGAGCTGGGG - Intronic
1064623509 10:17239487-17239509 TTGTTTGAATATGGGGGCTGAGG - Intergenic
1065138424 10:22696154-22696176 GTTGTTACACATGTTGGCTGAGG - Intronic
1065140028 10:22711548-22711570 GTGTTTGCATCTGTGAACTGAGG - Intronic
1065286145 10:24189474-24189496 GTGTGTGCACATGTGTGTTTGGG - Intronic
1066011912 10:31202161-31202183 GTGTCTGCAGATGAGGGCAGGGG - Intergenic
1069290356 10:66771579-66771601 GTGATTACACATATGGGCTGGGG + Intronic
1071526874 10:86364294-86364316 CTGTGTGCACGTGTGCGCTGAGG - Intronic
1075098285 10:119488087-119488109 GTGTTTGTCTATTTGGGCTGCGG - Intergenic
1076042450 10:127262278-127262300 GTGTGTGTACCTGTGTGCTGAGG + Intronic
1076270090 10:129144813-129144835 TTGTTAGTACATGTGGCCTGGGG - Intergenic
1076296024 10:129385511-129385533 CTGTTTGGACATGTGGAATGTGG + Intergenic
1076557357 10:131335924-131335946 GTATTTGGAGATGGGGGCTGTGG + Intergenic
1076874513 10:133209352-133209374 GTGTGTGCACATGTGGTGTGAGG + Intronic
1077024267 11:432334-432356 GTGGTTGCAGGTGCGGGCTGTGG - Intronic
1077438107 11:2554407-2554429 TTGTTTCCAAATTTGGGCTGGGG - Intronic
1077501644 11:2912187-2912209 GTGGTGGCACAGGAGGGCTGCGG + Intronic
1078066640 11:8083098-8083120 TTCTTGGCACATGTGGGCTGAGG + Intronic
1078948041 11:16093978-16094000 CTGTTTGCTCATGTGGACTCTGG - Intronic
1079091896 11:17486532-17486554 CTGTTTGCACACGTGGACTGTGG + Intergenic
1081526011 11:43928261-43928283 GAGGCTGCACATGTGGCCTGGGG + Intronic
1082090293 11:48083527-48083549 ACATTTGCACATGTGGGATGTGG - Intronic
1083865102 11:65449332-65449354 GTCTTTGCCCTTTTGGGCTGAGG - Intergenic
1084218724 11:67665244-67665266 GTCTTGGCCCAGGTGGGCTGCGG + Intronic
1084269592 11:68021891-68021913 GTCTTGGCCCAGGTGGGCTGTGG - Intronic
1085985228 11:81779028-81779050 GTGTGTGCACATGTGAGTTTTGG + Intergenic
1086853692 11:91841121-91841143 GCATCTGCACATGTGCGCTGGGG - Intergenic
1087223434 11:95571092-95571114 GTGCATGCATATGTGGGGTGGGG + Intergenic
1089632253 11:119791196-119791218 GTGTGTGCACATGTGGGCAGGGG + Intergenic
1090804025 11:130191328-130191350 GTGTTTCCTCATGTGGCCTGAGG - Intronic
1091196963 11:133739296-133739318 GTGTGTGTACATGGGGGATGGGG + Intergenic
1091352516 11:134908506-134908528 GTGTGAGCAAATGTGGGCAGGGG - Intergenic
1092029283 12:5270449-5270471 GTGTGTGCACATGATGCCTGTGG - Intergenic
1093235568 12:16605444-16605466 GTGTTTGGGCATGGGGGCGGGGG - Intronic
1094479153 12:30866845-30866867 GTGTGTGCACATGTGTGATTTGG - Intergenic
1097880261 12:64680376-64680398 GTGTCTGCACAAGTGGAGTGGGG - Intronic
1098000278 12:65934447-65934469 GTCGTTGAACAAGTGGGCTGGGG - Intronic
1098912665 12:76225614-76225636 GTGTTTGAACATATGAACTGGGG - Intergenic
1101073983 12:101109124-101109146 GCGTTTGCACAATTGGGTTGGGG + Intronic
1103449454 12:121018214-121018236 GTGTGTGTGCAGGTGGGCTGAGG + Intergenic
1104544940 12:129702049-129702071 GTGTTATCACAGCTGGGCTGAGG - Intronic
1104707357 12:130957133-130957155 GTGTTGGCACATGTGGGTGTGGG - Intronic
1104929610 12:132331265-132331287 GTGTATGCACATGTGTGTAGGGG + Intergenic
1105890168 13:24677010-24677032 CTACTAGCACATGTGGGCTGAGG + Intergenic
1106146962 13:27057918-27057940 AGTTTTGCACATGTGGGATGTGG + Intergenic
1106189105 13:27434993-27435015 GTGTGTGAACATGCTGGCTGTGG + Exonic
1106486070 13:30173881-30173903 GTGTGTGCACATGTGTGTGGGGG - Intergenic
1107631144 13:42343927-42343949 GGGTTTGATCTTGTGGGCTGTGG - Intergenic
1108339309 13:49481680-49481702 GTGTTTGGCCCTGGGGGCTGTGG - Intronic
1113870563 13:113557184-113557206 GTGTGTGCACATGTGTGTAGGGG + Intergenic
1114647686 14:24264584-24264606 GTGTGAGCACATGTGGGCCCAGG + Intergenic
1118483531 14:66190974-66190996 GTGTTTTCAGATGAGGTCTGTGG + Intergenic
1119326942 14:73765643-73765665 TTGTTTAGCCATGTGGGCTGAGG - Intronic
1122694150 14:103544671-103544693 CTGTGAGCACATGTGTGCTGCGG - Intergenic
1123054746 14:105563989-105564011 GTGTGTGCACGTGTGGGGTGTGG + Intergenic
1123079186 14:105683548-105683570 GTGTGTGCACGTGTGGGGTGTGG + Intergenic
1123412524 15:20072408-20072430 GTGTTTACACATATGGGGTTTGG + Intergenic
1123521866 15:21079521-21079543 GTGTTTACACATATGGGGTTTGG + Intergenic
1124250881 15:28105956-28105978 GTGTGTGCATGTGTGGGGTGTGG + Intergenic
1124267634 15:28251248-28251270 GGGTTTCCCCATGTTGGCTGGGG - Intronic
1124497221 15:30193798-30193820 GTGTGTTCATGTGTGGGCTGGGG + Intergenic
1124746353 15:32344849-32344871 GTGTGTTCATGTGTGGGCTGGGG - Intergenic
1124807896 15:32904893-32904915 GTGTTTGCTCTTGTGGGTAGAGG - Intronic
1127278330 15:57467365-57467387 ATGTTTGGGCATGCGGGCTGAGG + Intronic
1129722795 15:77887337-77887359 CTGTTAGCACATGTGGGTGGGGG - Intergenic
1131348416 15:91672975-91672997 GAGTTTACAGATGTGGGCAGGGG - Intergenic
1132096056 15:98985716-98985738 GAGGTTGCACATCTGGCCTGAGG - Intronic
1132261971 15:100433708-100433730 GTGTGTGCACATGTGTGCATGGG - Intronic
1132537366 16:489255-489277 GTGTTTGCACACTTGGCTTGCGG + Intronic
1135112430 16:19700704-19700726 GTCTTTGCACAAGTGGCCTTCGG + Exonic
1135348124 16:21706547-21706569 GTGTTTGCTCATCTGGTCTTGGG - Intronic
1135632953 16:24050236-24050258 GTGTTTGAGGTTGTGGGCTGTGG - Intronic
1136653485 16:31693741-31693763 GTGTGTGCATGTGTGTGCTGTGG - Intergenic
1137454189 16:48605722-48605744 GTGTTTACACCTCTGGGCTGGGG - Intronic
1137932554 16:52602859-52602881 GTGTGTGTATATGTGGGGTGGGG - Intergenic
1138090065 16:54166559-54166581 GTGTCTGCACATCTGGCATGTGG + Intergenic
1139082854 16:63546693-63546715 GAGGTTGCACATGTAGGGTGAGG - Intergenic
1140277618 16:73524838-73524860 GTCTTTCCCCAGGTGGGCTGAGG + Intergenic
1140476354 16:75241173-75241195 GTGTTTACACATATGGGGTTTGG + Intronic
1140554754 16:75909071-75909093 GTTTTTGCAAAAGTGGGCTGTGG + Intergenic
1141103069 16:81212067-81212089 GTGTTTGCTCTTCTGGGTTGCGG + Intergenic
1141203274 16:81913689-81913711 GTGTTTCCACATGGGCGCGGTGG + Intronic
1142001059 16:87664770-87664792 ATGTTTCCACATGTGAGCTGTGG - Intronic
1142268371 16:89076627-89076649 GTGTGTGCACATGTGGAATATGG + Intergenic
1143272221 17:5684175-5684197 GTGTTTACCCTTGTGGGGTGGGG - Intergenic
1143962379 17:10731325-10731347 GTGTTTGCAGAGGTGGGGTGGGG + Intergenic
1144030735 17:11320331-11320353 GTGTTTGTGCATGGGGGGTGGGG + Intronic
1144138267 17:12320205-12320227 GTGTTTAAGCATGTGGGCTCTGG + Intergenic
1144808862 17:17985730-17985752 GTGTTTACCAATGGGGGCTGAGG - Intronic
1144831199 17:18132119-18132141 GTGTGTGCACATGTGGGCTATGG + Intronic
1147813286 17:43189154-43189176 GTGTTGGCACAGGTGGAATGTGG + Intronic
1147875391 17:43617149-43617171 GTGTGTGCACCTCTGGGCTGAGG + Intergenic
1149270235 17:54969105-54969127 GTGGGTGCCCATGAGGGCTGCGG - Intronic
1149950019 17:60975963-60975985 TTGTTTCCACATTTGGGCTTAGG + Intronic
1150352828 17:64458924-64458946 GTGTTTGCACATGTGGGCTGGGG + Intronic
1150436467 17:65158041-65158063 GTGTATGTATGTGTGGGCTGGGG + Intronic
1151879098 17:76884332-76884354 GTGCTTAGAAATGTGGGCTGTGG - Intronic
1152150316 17:78595612-78595634 GTGGTTGCTCATGTTGGCTCAGG + Intergenic
1152515003 17:80817869-80817891 GTGGTTGCACAAATGGGGTGTGG + Intronic
1152533880 17:80939326-80939348 GTGCACGCACATGTGGGTTGGGG - Intronic
1154406341 18:14095459-14095481 GTCTTTGCAGCTGTGGGCTTTGG - Intronic
1155622398 18:27794730-27794752 GAGTTTGGACATGTGGGATGGGG - Intergenic
1157984686 18:52423635-52423657 CTGTTTACACATATGTGCTGAGG + Intronic
1160202391 18:76806576-76806598 GTGTGTGCACATGAGGGCCCCGG - Intronic
1160394921 18:78564076-78564098 GGGTGTGCAGATGTGGGGTGTGG - Intergenic
1160910668 19:1472422-1472444 CTGTTTCCCCATGTGGGCCGTGG + Exonic
1161151348 19:2711647-2711669 GTGTTTGCTGATGTGGGAAGCGG - Intergenic
1161952634 19:7476413-7476435 GTCTGTGCACATGTGGCCTCTGG - Intergenic
1163127637 19:15252885-15252907 GTGTGTGCACAGATGGGGTGGGG - Intronic
1163130130 19:15267274-15267296 GTGTTTGGACATGTGAGATTGGG - Intronic
1163356237 19:16813124-16813146 GTGTGTGCACTTCTGGGCTCAGG + Intronic
1164738271 19:30558442-30558464 GCGTTTCCACATCTGGGATGGGG - Intronic
1164977558 19:32584842-32584864 GTGTCTCCACATGGGGCCTGCGG - Intronic
1168059203 19:53882070-53882092 GTGTGTGCACGTGTGGGGGGCGG + Intronic
925350799 2:3199750-3199772 GTGTGTCCACATCTGGGCAGAGG + Intronic
925836650 2:7952944-7952966 CTATTTACACATGTGAGCTGAGG + Intergenic
926127131 2:10278504-10278526 GTGTTTTCAGATGTGGGTGGTGG + Intergenic
927678421 2:25123783-25123805 GTGTGTGCACGTGTGTGCAGTGG - Intronic
927940038 2:27097764-27097786 GTGTTTGAAGATGGGGGATGGGG + Intronic
929581802 2:43086054-43086076 GTGTGTGCACGTGTGTGGTGGGG - Intergenic
930253612 2:49064084-49064106 GTGTTTGCACATGCATGGTGGGG + Intronic
932188497 2:69718644-69718666 GTGTATGCATGTGTGTGCTGTGG - Intronic
932758278 2:74423562-74423584 GTGCTGGGGCATGTGGGCTGTGG + Intronic
934014623 2:87866701-87866723 GTGTCTGCACATGTGGGGCGAGG + Intergenic
934046303 2:88175392-88175414 GTGTTTGGAGGTGTGTGCTGAGG + Exonic
936611543 2:114006576-114006598 GTGTTTGCAGAAGTGTGCTGTGG - Intergenic
937610118 2:123850861-123850883 GTGGTTGGGCATGTGGGCTTGGG + Intergenic
937669766 2:124525910-124525932 CTGTTTTCACTGGTGGGCTGTGG - Intronic
938138288 2:128776638-128776660 GTGGTTACACAGGTGGCCTGTGG - Intergenic
938383609 2:130850014-130850036 GTAACTGCACATGTGGTCTGGGG + Intronic
939586496 2:144012286-144012308 GTGTTTGGACATGGGGACTGTGG - Intronic
939959188 2:148551143-148551165 GAGCTTGCACATGTGGGATACGG - Intergenic
940192194 2:151053790-151053812 GTGTTGGCACATTTCTGCTGTGG - Intergenic
941039507 2:160604850-160604872 GTGGTTGGACATTTGGGCTCTGG - Intergenic
942966537 2:181900524-181900546 ATGTTTACACATGTGTACTGGGG - Intronic
944426856 2:199592521-199592543 CTGTTAACACATGTGGGCTGAGG - Intergenic
945037432 2:205716231-205716253 GTGTTTGCCCAGGAGGTCTGCGG - Exonic
946718700 2:222581017-222581039 CTGTTGGCTCATGTGGGCTGTGG - Intronic
947905318 2:233757130-233757152 GAGCTTGGACAGGTGGGCTGGGG + Intronic
948337518 2:237222041-237222063 GTGATTGCAAATGTTAGCTGTGG + Intergenic
948676434 2:239599694-239599716 ATGAATGAACATGTGGGCTGCGG - Intergenic
948768871 2:240237115-240237137 GTGTGTATACATGTGGGGTGGGG + Intergenic
1169258108 20:4114273-4114295 GTGTTTGCACGTGTGAGCCTGGG + Intergenic
1171793897 20:29551661-29551683 GGGTCTGCATATGTGGGCTTGGG + Intergenic
1172030164 20:31976262-31976284 GTGGTTCCACATGTGGGTTTGGG - Intronic
1172778307 20:37420679-37420701 GTGTTTGCACATGGGGAAGGAGG - Intergenic
1174087804 20:48021482-48021504 AGGCTTCCACATGTGGGCTGTGG + Intergenic
1174253869 20:49239474-49239496 ATGTTTCCACATTTGGGGTGTGG + Intronic
1174407270 20:50310504-50310526 GTGTGTGCACGTATGGGGTGGGG + Intergenic
1175720462 20:61283379-61283401 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720463 20:61283418-61283440 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720464 20:61283457-61283479 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720470 20:61283568-61283590 GCATTTGCACGTGTGTGCTGTGG + Intronic
1175720471 20:61283607-61283629 GCATTTGCACGTGTGTGCTGTGG + Intronic
1177743485 21:25182024-25182046 GTGTTTTCACATGTGAGATCTGG - Intergenic
1179171104 21:38973459-38973481 CTGTTTGCAGATGTCAGCTGTGG - Intergenic
1179309713 21:40185001-40185023 GTGTCTCCACATGTTGGGTGCGG + Intronic
1179403571 21:41107338-41107360 GTGTTTGCATCTGTGGATTGGGG - Intergenic
1179413480 21:41179568-41179590 GTGAGTGCACATGTGTGGTGAGG + Intronic
1180817664 22:18802109-18802131 GTCCTTGCACCTGTGGGCTCAGG - Intergenic
1181203879 22:21236564-21236586 GTCCTTGCACCTGTGGGCTTAGG - Intergenic
1182093971 22:27614089-27614111 GTGTGGCCACACGTGGGCTGGGG + Intergenic
1182823035 22:33235499-33235521 GTAGTTGCAAATGTTGGCTGAGG + Intronic
1182973459 22:34599617-34599639 GTGATTGCACAGGTGGATTGAGG + Intergenic
1184554579 22:45226238-45226260 GTGGTCACACATGTGGCCTGGGG - Intronic
1184568590 22:45308542-45308564 GTGGTTACATGTGTGGGCTGAGG + Intergenic
1185370609 22:50459256-50459278 GTGACTGCCCATGTGGGCTGAGG + Exonic
1203223042 22_KI270731v1_random:58850-58872 GTCCTTGCACCTGTGGGCTTAGG + Intergenic
1203267787 22_KI270734v1_random:27970-27992 GTCCTTGCACCTGTGGGCTTAGG - Intergenic
949255000 3:2035543-2035565 GTGTGTGCACACATGTGCTGAGG - Intergenic
949871882 3:8596073-8596095 GTGATCGCAGATGTGGGGTGGGG + Intergenic
949988378 3:9557267-9557289 GTGCTTGAACATGGGGGCGGAGG + Intergenic
950109306 3:10408352-10408374 GTTTTTGCACTTGGTGGCTGGGG + Intronic
950114754 3:10443554-10443576 GTTTTAGCACATGGGGGCTCCGG - Intronic
951812345 3:26714765-26714787 GTGTGGGCAAATGTGGGATGAGG - Intergenic
953004836 3:38968579-38968601 GTGTGTGCACATGTGTGTTGGGG - Intergenic
953541680 3:43824700-43824722 GTGTGTGCACAGGTGTGCTTAGG + Intergenic
954092309 3:48294931-48294953 ATGTTGGCAGATGTGGCCTGTGG - Intronic
955912360 3:63870381-63870403 GTGTGTGCACATGTTGGGGGTGG - Intronic
957108551 3:75923804-75923826 GAGTTTGCACATGTGTGCACTGG + Intronic
958451709 3:94281159-94281181 ATGTATTCACAAGTGGGCTGTGG + Intergenic
961219154 3:125186334-125186356 GTGTGTGCATGTGTGGGCGGTGG - Intronic
961220454 3:125195010-125195032 GTAGCTGCACATGTGGACTGTGG - Intronic
961371902 3:126436322-126436344 TTGTTTGATCCTGTGGGCTGGGG - Exonic
961655354 3:128438771-128438793 GTGTCTCCACATCTGGGCTCTGG + Intergenic
961983964 3:131112851-131112873 TTGTTTGCAAAGGTAGGCTGAGG + Intronic
964087762 3:152837198-152837220 GTGTGTGCACATGAGTACTGGGG + Exonic
964507743 3:157417986-157418008 GAGCTTGCATATGTGGACTGGGG - Intronic
967832726 3:193934444-193934466 TTGTTTGCACAATTGGGATGTGG + Intergenic
967993672 3:195150757-195150779 GTGTGTGCGTATGTGGGCTGTGG - Intronic
968706080 4:2078422-2078444 GGGTCTGCCCAGGTGGGCTGGGG - Intronic
969274931 4:6128601-6128623 GTGTTTGCTCATCCGGGCTGGGG - Intronic
969442712 4:7226796-7226818 GTGCTTGAAGATGTGGCCTGGGG - Intronic
970723376 4:19014273-19014295 GTGCATGCACATGTGTGGTGTGG + Intergenic
971306068 4:25482736-25482758 GAGGTTATACATGTGGGCTGTGG + Intergenic
972802482 4:42491697-42491719 TTCTTTGCACATCTGGCCTGTGG - Intronic
975213550 4:71728760-71728782 GTGTTTAGACATGCGGGCTGAGG - Intergenic
975680679 4:76872792-76872814 GTTTTCTCACATGTGGTCTGTGG - Intergenic
976808014 4:89070065-89070087 TTGTTAGCACATCTGGGTTGTGG - Intronic
977558988 4:98513355-98513377 GTCTTTGCAGATCTGGGCTTTGG + Intronic
979135163 4:117102277-117102299 GTGTTTGTACATCTGTGCTCTGG - Intergenic
979907703 4:126317396-126317418 GTGTTTGCAAATGCTGACTGAGG + Intergenic
981635372 4:146872219-146872241 GTGTGTGCACATGTGGTGTGAGG - Intronic
985540621 5:485833-485855 GGGTTTGCAAATGCAGGCTGGGG + Intronic
985702435 5:1381769-1381791 GTGTGTGCACATGTGGGTGTGGG - Intergenic
985924443 5:3004850-3004872 GCATTTGCACAGGTGGACTGTGG - Intergenic
986235315 5:5904266-5904288 GAGTTTGCTGATGTGGCCTGTGG + Intergenic
986251299 5:6060846-6060868 GTGTGTGCACATGTGTGCGGGGG - Intergenic
986806236 5:11311350-11311372 GTATATGTACATGTGGGTTGAGG - Intronic
987095686 5:14547105-14547127 TTGTTTGCACAGGTGAGGTGAGG - Intergenic
990312596 5:54553981-54554003 GTGTTTGCACATTAGGGCATGGG - Intergenic
990511115 5:56489876-56489898 GTTACTGTACATGTGGGCTGAGG - Intergenic
992207926 5:74449026-74449048 GTGTTTGGAGATGTGGCCTTTGG - Intergenic
993885246 5:93408480-93408502 CTGCTTGCACATTTGGGGTGTGG - Intergenic
994056190 5:95418900-95418922 GTAATTTCACAAGTGGGCTGGGG - Intronic
994838529 5:104889853-104889875 GTGTTTGTACATGTGTGCCTGGG - Intergenic
994995352 5:107055289-107055311 GTGATTGCCCATTTGGGTTGGGG + Intergenic
995022822 5:107385070-107385092 GTGTGTGCATACGTGTGCTGGGG - Intronic
996200104 5:120661953-120661975 GAGCTTGGAAATGTGGGCTGGGG + Intronic
996785979 5:127237151-127237173 ATGTTTGCACATCTGGGTTTTGG + Intergenic
997000226 5:129750811-129750833 GTGTGTGCACATGGTGGTTGAGG + Intronic
997236087 5:132272650-132272672 GTGTGTGCAAAGGTGAGCTGGGG + Exonic
998339614 5:141405263-141405285 GTGTCTGCATAGTTGGGCTGGGG - Exonic
998454719 5:142262823-142262845 CTTTTAGCACATGTAGGCTGTGG + Intergenic
999237454 5:150107623-150107645 GTGGTTGAACATGTGGGCTCTGG - Intronic
999498140 5:152120183-152120205 GAGGTTGCAGATGTGGGCAGAGG + Intergenic
1000760145 5:165213496-165213518 GTATGTGCACATGTGTGCTGGGG - Intergenic
1000766557 5:165298722-165298744 GTGTTTGTACATGTGGTTTGGGG + Intergenic
1000895230 5:166847275-166847297 GTGTGTGCACGTGTGTGTTGGGG + Intergenic
1001293504 5:170483113-170483135 GTGTGTGCACCTGCAGGCTGTGG + Intronic
1002052002 5:176576536-176576558 GTGTTGGGACAAGTGGTCTGAGG + Intronic
1002172886 5:177385225-177385247 GTGGCTGCAGGTGTGGGCTGGGG - Intronic
1002318527 5:178361427-178361449 ATGTGGGCACATGTGGCCTGAGG + Intronic
1003286660 6:4740223-4740245 CTGTTAGCACACGTGGGATGAGG - Intronic
1003985069 6:11427237-11427259 GTGTGTGCACATGTGGTGTTGGG - Intergenic
1006480347 6:34287899-34287921 GTTTTTACAGATCTGGGCTGAGG + Exonic
1006847022 6:37069383-37069405 CTGTTTGCACATGTGCAGTGAGG - Intergenic
1006988517 6:38193348-38193370 GTGATGGCACATGGGGGTTGTGG + Intronic
1007220757 6:40276959-40276981 GTGTTTGCACATATGACTTGTGG - Intergenic
1007630648 6:43271432-43271454 GTGTATGCACATGTGTGTTAGGG + Intronic
1010120579 6:72371169-72371191 GTGTGTGCACATGTGTGGTCTGG + Intronic
1010158994 6:72829871-72829893 GTAATTCCAAATGTGGGCTGAGG + Intronic
1011088947 6:83573089-83573111 GTAATTCCAAATGTGGGCTGAGG + Intronic
1011201794 6:84845042-84845064 GTGTGTGGCCATGTGAGCTGTGG + Intergenic
1017077044 6:150628938-150628960 GTGTGTGCATATGTGGGATTTGG + Intronic
1019712410 7:2523699-2523721 GTGCTGGCACAGGTGGGCTGTGG + Intronic
1020700597 7:11477613-11477635 TTGTTTGCAAATGTGGTCAGTGG + Intronic
1020744342 7:12062985-12063007 TTGTTTGCACATATTGGCTATGG - Intergenic
1022620553 7:31979611-31979633 GTGCTTACATATGTGGGCTCTGG - Intronic
1024466538 7:49717172-49717194 GTGTTTGCAAGTGTGGCCTTGGG - Intergenic
1026056572 7:66989626-66989648 GTGTTTGAAGCTGTGGGGTGAGG + Intronic
1026698111 7:72613984-72614006 ATGTGTGCACATGTATGCTGGGG + Intronic
1026721525 7:72835435-72835457 GTGTTTGAAGCTGTGGGGTGAGG - Intergenic
1027636198 7:80678107-80678129 GTGTGTGCACATATGCACTGTGG + Intronic
1028399760 7:90412446-90412468 GTGTGTGCACCTGTGCTCTGAGG + Intronic
1029734962 7:102460509-102460531 GTGTTAGCTCAAGAGGGCTGCGG - Intronic
1029791376 7:102846424-102846446 GTGTTTCACCATGTTGGCTGAGG - Intronic
1029791414 7:102846791-102846813 GTGCTTGCATAGGTGGCCTGTGG - Intronic
1029847090 7:103423527-103423549 GTGATTGATCATGTGGGCTCTGG + Intronic
1031432273 7:121686456-121686478 GTGTTTGGACATGGGGTCTTTGG - Intergenic
1031712326 7:125064329-125064351 GTGCTTGCTCATGTTGGGTGAGG + Intergenic
1031904636 7:127447158-127447180 GTTTCTGCACAGGAGGGCTGGGG - Intergenic
1032526796 7:132583879-132583901 GTGGTAGCACATGAGGGTTGGGG + Intronic
1033004919 7:137551269-137551291 GTGGTGGCACATGTTGGTTGAGG - Intronic
1033592661 7:142825640-142825662 CTGTTTGCACATCTCTGCTGGGG + Intergenic
1035067302 7:156116261-156116283 GTGTGTGCACATGAATGCTGTGG - Intergenic
1036071993 8:5451049-5451071 GTTTTAGCACATCTGGGTTGGGG - Intergenic
1036201532 8:6774715-6774737 GCGTGTGCACCTGTGTGCTGAGG - Intergenic
1036212201 8:6851782-6851804 GTGTGTGCATATGTGGGCGTGGG - Intergenic
1036608672 8:10330913-10330935 GTGTTTGGACATGGGGCCTTTGG + Intronic
1037310641 8:17551913-17551935 GCGTTTGAATATGTGGGATGGGG + Exonic
1037907915 8:22726314-22726336 ATGTGTGGGCATGTGGGCTGTGG + Intronic
1037916371 8:22775721-22775743 GTGAGTGCACAGGAGGGCTGAGG - Intronic
1041372756 8:57180573-57180595 GTGTGTACACATGTGTGTTGGGG + Intergenic
1043389261 8:79776367-79776389 GTGTATGCACATGTGTGTGGGGG - Intergenic
1044630277 8:94271883-94271905 GTGTGTGCACATGTGGGGGGAGG + Intergenic
1044630284 8:94271918-94271940 GTGTGTGCACATGTGGGGGGAGG + Intergenic
1044630290 8:94271953-94271975 GTGTGTGCACATGTCGGGGGAGG + Intergenic
1044770177 8:95623052-95623074 GAGTTTGCACATGTGGCTTCAGG + Intergenic
1046318192 8:112535060-112535082 GTTTTTGCCCATATTGGCTGTGG - Intronic
1047445209 8:124913412-124913434 GTGTTTCCCCATGTGGCCTTGGG + Intergenic
1047684923 8:127295238-127295260 GTGTTTGCAAGCATGGGCTGCGG + Intergenic
1048026349 8:130590513-130590535 GTAATAGCACATGTGGGCTCTGG + Intergenic
1048406634 8:134129126-134129148 CTCTTTCCACATGTGGGATGCGG + Intergenic
1048865369 8:138757032-138757054 GTGTGTGCACGTGTGTGCAGGGG - Intronic
1049342872 8:142123053-142123075 GTGTGTGCGCACATGGGCTGTGG - Intergenic
1049749230 8:144275662-144275684 GTGGTGGCTGATGTGGGCTGGGG - Intronic
1050042078 9:1506611-1506633 GTGTGTGCACGTGTGTGGTGTGG + Intergenic
1050267610 9:3907146-3907168 GTGATTGGACATGTGCACTGGGG + Intronic
1051142634 9:13994175-13994197 TGGTTTTCCCATGTGGGCTGAGG + Intergenic
1056721592 9:89076621-89076643 GTGTTTGAACATGCAGCCTGTGG + Intronic
1056765034 9:89439980-89440002 GTGTGTCCACTTTTGGGCTGTGG - Intronic
1056914236 9:90730707-90730729 GAGTTTGGATAAGTGGGCTGGGG - Intergenic
1057453103 9:95182987-95183009 GAGTTTGCGCAGGCGGGCTGAGG - Intronic
1059319856 9:113461221-113461243 GTGTGTGCACATGTGTGAGGTGG + Intronic
1059452306 9:114378021-114378043 GAGTTTTCAGATGTGGGATGTGG - Intronic
1060400566 9:123346437-123346459 GTGTTTGTAGATGTGTACTGAGG + Intergenic
1060488691 9:124065783-124065805 GTGTTTGCCCATTTGCGGTGAGG + Intergenic
1060985315 9:127816115-127816137 GTGCTGGCCCATGTGGGCTTTGG + Intronic
1062153527 9:135033649-135033671 GGGTGTGCATATGTGGGCAGGGG - Intergenic
1062182685 9:135199198-135199220 GTGGTGGCACCTCTGGGCTGCGG - Intergenic
1062205970 9:135337559-135337581 GTGTATGCACATGTGTGCAGGGG + Intergenic
1062366211 9:136210370-136210392 GTGGGGGCACATGCGGGCTGGGG + Intronic
1185525057 X:771926-771948 GTGTTTGGAAATGCGGGGTGGGG - Intergenic
1185769813 X:2757254-2757276 CTGTCTGCACATGGGGTCTGGGG + Intronic
1187029222 X:15468438-15468460 TTGTTTGCACATATGGTCTTGGG + Intronic
1187644171 X:21328572-21328594 GTGCTGGCACATGTGGGAGGTGG - Intergenic
1187734821 X:22292842-22292864 GGGTTTGCAGATGGAGGCTGTGG - Intergenic
1188839551 X:34999280-34999302 ATGTTAGGATATGTGGGCTGTGG - Intergenic
1188923243 X:36005671-36005693 GTGTGTGCACATGTGTGCAATGG + Intergenic
1193082822 X:77422613-77422635 GAGTTTGCAGGTGTGGGCAGAGG - Intergenic
1194426375 X:93743463-93743485 GTTTTTACAAATGTGGGTTGAGG + Intergenic
1196310699 X:114162088-114162110 ATGTGTGCAAATGTTGGCTGTGG + Intergenic
1199129855 X:144171810-144171832 GTGTCTGCACATGTGGGGCGAGG - Intergenic
1199398505 X:147368677-147368699 GTGTTGGCACCTATGGCCTGTGG - Intergenic
1199603616 X:149559000-149559022 TGGTTAGCACATGTGGGGTGAGG - Intergenic
1199646771 X:149920474-149920496 TGGTTAGCACATGTGGGGTGAGG + Intergenic
1201300710 Y:12502379-12502401 CTGTTTTCACATGGGGTCTGGGG - Intergenic
1201518027 Y:14839431-14839453 TTATTTGCACAAGTGGGCAGAGG - Intronic