ID: 1150360395

View in Genome Browser
Species Human (GRCh38)
Location 17:64527809-64527831
Sequence CTCAGTCATGTCCAGCAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 117}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150360395 Original CRISPR CTCAGTCATGTCCAGCAGTA GGG (reversed) Intronic
902052860 1:13577926-13577948 CACAGCCACGTCCAGCAGTGGGG + Intergenic
903578606 1:24354427-24354449 CTCCCCCATGTCCAGCAGGAAGG - Intronic
907530267 1:55088625-55088647 CTCAGTGAAGTCGAGCGGTAAGG + Intronic
910846879 1:91612323-91612345 CTCAGTCATGTCCTTCATTCCGG - Intergenic
910894481 1:92053722-92053744 TTCTGGCATGTGCAGCAGTATGG + Intronic
912308718 1:108597469-108597491 CTCAGTCATCTGCAGGAGTCAGG + Intronic
915566332 1:156715412-156715434 CTTAGCCTTGGCCAGCAGTAAGG - Intergenic
917212598 1:172645529-172645551 TTCAGTGAAGTCCAGGAGTAGGG + Intergenic
922603063 1:226871257-226871279 ATCAGGCATTTCCAGCAGTGAGG + Exonic
923009000 1:230073509-230073531 CTTAGTCATGTCTACTAGTATGG + Intronic
1070146892 10:73781127-73781149 CTCAGTCATGTAAAGCACTTTGG + Intergenic
1071524650 10:86351421-86351443 CTCAGAAATGTCCAGCAGGCTGG - Intronic
1074326156 10:112453494-112453516 TTCAGTCATTTACATCAGTATGG + Intronic
1074416281 10:113269683-113269705 CTCAGTCCTTACCAGCAGAATGG + Intergenic
1078713305 11:13815998-13816020 CTGAGTCATGTCCTTGAGTAGGG + Intergenic
1080744616 11:35097654-35097676 CTGGGGCCTGTCCAGCAGTAAGG + Intergenic
1084325281 11:68396650-68396672 CACAGTCAAGGCCAGCAGGAGGG - Intronic
1085394219 11:76198557-76198579 TTCATTCATGTCCAGAAGCAGGG - Intronic
1085543151 11:77291204-77291226 TTCTGTCATTTGCAGCAGTATGG + Intronic
1088493939 11:110414460-110414482 CTCAGTCAGGTCCTTCAGAAGGG + Intergenic
1089159853 11:116429006-116429028 CTCAGTCATTTCCAAAGGTAAGG - Intergenic
1089414850 11:118279258-118279280 CTCAGTGATGCTAAGCAGTATGG + Intergenic
1090334445 11:125953403-125953425 CTCAGCCACGTCCAGCTGTGGGG - Intergenic
1093087791 12:14886029-14886051 CACAGTCAGGTCCAGCAGTTAGG - Intronic
1102469237 12:113150249-113150271 CTCCTTCATGTTCAGCAGCATGG + Intronic
1103183026 12:118930974-118930996 CTCTGTCAAGTCCTGCAGGAAGG + Intergenic
1111707916 13:91774613-91774635 CACCATCATGTCCAGCAGTAGGG - Intronic
1112816908 13:103283398-103283420 CTCAGTCAGCTCCTACAGTAGGG + Intergenic
1113950435 13:114068526-114068548 CACCGTCTTGTCCAGCAGAAAGG - Intronic
1115597641 14:34924517-34924539 CTCACTCATGACCAGGAGGAGGG - Intergenic
1202835999 14_GL000009v2_random:77534-77556 CTCCATCCTGTCCAGCAGGATGG + Intergenic
1124054911 15:26233403-26233425 CTCTGTCATTTGCAGCAATATGG - Intergenic
1124685893 15:31781655-31781677 CTATGTCATGTCCAGCCATAGGG - Intronic
1126196865 15:45941329-45941351 CTCAGGCAGGTCCTGCAGAAGGG - Intergenic
1126872027 15:52999971-52999993 CTCTGTCATTTACAGCTGTAAGG - Intergenic
1128649971 15:69403641-69403663 CAGAGTCTTGTCCAGAAGTATGG - Exonic
1129096182 15:73211133-73211155 TTCGGTCATGGCCAGAAGTAAGG - Intronic
1129944452 15:79526914-79526936 CTCAGTCAGATCCAGCTGAAGGG + Intergenic
1137567102 16:49540088-49540110 CTTGGTCATGTCCAGTAGGAAGG - Intronic
1140632784 16:76873755-76873777 CACAGTCATCTCCAGAAGTGTGG + Intergenic
1146706560 17:35004548-35004570 CTGAGTCCAGTCCAGTAGTATGG - Exonic
1150199651 17:63341584-63341606 GCCAGTCATGTCCAGCAATGAGG - Intronic
1150360395 17:64527809-64527831 CTCAGTCATGTCCAGCAGTAGGG - Intronic
1154435019 18:14336184-14336206 CTCCATCCTGTCCAGCAGGATGG + Intergenic
1154499697 18:14989728-14989750 CTCTGTCATGCCCAACAGCATGG + Intergenic
1156688518 18:39678394-39678416 TTCAGTCATTTGCAGCAATATGG - Intergenic
1160188061 18:76690949-76690971 GTCATTCAGGGCCAGCAGTAGGG - Intergenic
1161613527 19:5257276-5257298 CTCAGTCATGCCCAGCAGCGTGG - Intronic
1165684838 19:37810733-37810755 CTCAGGCATGTCCTTCAGGAGGG - Intronic
1168561720 19:57390092-57390114 CTCAGTCAGGTTCATCAGCAAGG - Exonic
1202636639 1_KI270706v1_random:49828-49850 CTCCATCCTGTCCAGCAGGATGG - Intergenic
927955029 2:27201945-27201967 CACAGTCATGTGTAGCAGGATGG - Intronic
928306604 2:30175010-30175032 CGCAGCCATGTGCAGCAGCAAGG - Intergenic
930457353 2:51622343-51622365 CTCAGTCATGTAGAACTGTAAGG - Intergenic
930652784 2:53979089-53979111 CTCAGGCAGGTCCTTCAGTAGGG + Intronic
931582985 2:63797060-63797082 CCCAGTCATGTCCAGGAGATAGG - Intronic
933124071 2:78581793-78581815 CTCACTAATGTACAGTAGTATGG - Intergenic
933133368 2:78701003-78701025 CTCAGTCATGTTAATCAATAAGG - Intergenic
934491018 2:94762123-94762145 CTCCATCCTGTCCAGCAGGATGG - Intergenic
937390569 2:121482348-121482370 CCAAGTCATGTCCAGGAGTTAGG + Intronic
939913988 2:148018046-148018068 CTCAGGGATTTCTAGCAGTATGG - Intronic
940531284 2:154880571-154880593 TTCTGTCATTTGCAGCAGTATGG - Intergenic
941526889 2:166617647-166617669 CTCAGTCATGTCCGGAAGACTGG + Intergenic
948152020 2:235751967-235751989 CTCACTCATGTTCACCAGCACGG - Intronic
1171882774 20:30630759-30630781 CTCCATCCTGTCCAGCAGGATGG - Intergenic
1171935613 20:31272460-31272482 CTCACTCCTCTCCAGCAGTGGGG + Intergenic
1172091482 20:32435948-32435970 CTCAGTACTGGCCAGCAGTAGGG - Exonic
1175501395 20:59453471-59453493 CTGTGTCATGTCCATCAGTAGGG + Intergenic
1176842018 21:13849518-13849540 CTCCATCCTGTCCAGCAGGATGG - Intergenic
1177322165 21:19536604-19536626 TTGAGACATGACCAGCAGTAAGG - Intergenic
1179921797 21:44511640-44511662 CTCAGTCTTTTCCAGCAATGTGG - Intronic
1180000003 21:44991269-44991291 CTCAGCCCTGTCCAGGAGTGTGG + Intergenic
1180241633 21:46511111-46511133 CACAGTCCTGTCCAGAAGTTGGG + Intronic
1180364231 22:11924485-11924507 CTCCATCCTGTCCAGCAGGATGG + Intergenic
1181422210 22:22810133-22810155 CTCAGTCTTGTCCACCAGCAGGG + Intronic
1182414075 22:30209878-30209900 CTCAGTCTTTTCCATCAGGAAGG - Intergenic
1184556067 22:45233735-45233757 CTCGGTCATTTCCAGCAGCTTGG - Intronic
949662729 3:6298932-6298954 CTCAGACATGACCAGAAATAGGG + Intergenic
951480905 3:23161444-23161466 ATCATTTATGTCCAGCAATAGGG - Intergenic
954290396 3:49646889-49646911 CTTAGGCATGTCCAGCAACAGGG + Intronic
954422712 3:50427033-50427055 CACACTCATGTCCAGCTGTTGGG + Intronic
958192614 3:90202337-90202359 CTCACTCATGTCCATCATTTTGG - Intergenic
958416032 3:93874266-93874288 CTCACTCATGTCCATCAGTTTGG - Exonic
960487493 3:118271153-118271175 TACAGTCATGGCCAGCAGTCTGG - Intergenic
962746623 3:138401903-138401925 GTCAGTCATTCCCATCAGTAGGG + Intronic
965681270 3:171253974-171253996 CTGAGTCATGTCCAGAAAAATGG - Intronic
967392358 3:188969229-188969251 CTGAGGCATGGCCAGCATTAGGG - Intronic
967488137 3:190057900-190057922 CTCAGTCATTCCCAGAACTAAGG + Intronic
967776556 3:193391947-193391969 CTCAGTCTCGTGCAGCAGTCAGG - Intergenic
968349990 3:198046075-198046097 CTCCATCCTGTCCAGCAGGATGG - Intergenic
971999341 4:34009742-34009764 ATCATTCCTGGCCAGCAGTAGGG - Intergenic
973366452 4:49213198-49213220 CTCCATCCTGTCCAGCAGGATGG - Intergenic
973394160 4:49579236-49579258 CTCCATCCTGTCCAGCAGGATGG + Intergenic
982224345 4:153152515-153152537 CTCAATCTTGTCAAGCAGGAAGG - Intronic
985123464 4:186667293-186667315 GACAGTCATGTCCATCAGGAGGG + Intronic
1202763955 4_GL000008v2_random:135700-135722 CTCCATCCTGTCCAGCAGGATGG - Intergenic
991056530 5:62326647-62326669 CTGAGTCATTTCCATCAATATGG + Intronic
1003741156 6:8941760-8941782 CTCTGTCATGGACAGCAGCAAGG + Intergenic
1004379321 6:15118590-15118612 CTCAGTAGTTTCCAGCAATAAGG + Intergenic
1006914021 6:37583162-37583184 CTCATTCATGCCCAGGAGAAAGG - Intergenic
1013349577 6:109293070-109293092 ATCAGTCATTTGCAGCAGCACGG + Intergenic
1015013360 6:128378210-128378232 CTCAGTTTTGTCCAGAAGCAAGG - Intronic
1021042316 7:15877402-15877424 CTCAGTTGTATGCAGCAGTAAGG + Intergenic
1027423762 7:78041832-78041854 GTCAGTCTTTTCCAGCAGGAAGG - Intronic
1042007812 8:64201839-64201861 CATAGTCATGTCCAAAAGTATGG - Intergenic
1042027745 8:64442108-64442130 CTCAGTCTGGTCCAGCAGAAGGG - Intergenic
1049363240 8:142224289-142224311 CTCAGTCATGACAGGCATTAGGG - Intronic
1049942117 9:556875-556897 CTCAGTAATGACATGCAGTATGG + Intronic
1052335624 9:27316803-27316825 CTCAGCCAGGTCCAGCCGCAGGG + Intergenic
1052635165 9:31093775-31093797 CTCAGAAATACCCAGCAGTAAGG + Intergenic
1052880746 9:33599746-33599768 CTCCATCCTGTCCAGCAGGATGG + Intergenic
1053054369 9:34985709-34985731 CTCAGCCATGTCTAGGAGGAGGG + Intergenic
1053495222 9:38544464-38544486 CTCCATCCTGTCCAGCAGGATGG - Intronic
1053666969 9:40323558-40323580 CTCCATCCTGTCCAGCAGGATGG + Intronic
1053916560 9:42948667-42948689 CTCCATCCTGTCCAGCAGGATGG + Intergenic
1054378118 9:64463586-64463608 CTCCATCCTGTCCAGCAGGATGG + Intergenic
1054517641 9:66052725-66052747 CTCCATCCTGTCCAGCAGGATGG - Intergenic
1055090473 9:72360474-72360496 ATCAGTCATGTCAAGCACTTGGG + Intronic
1056961416 9:91127306-91127328 CTCAGGCAGGTCCTGCAGGAGGG + Intergenic
1057380205 9:94560470-94560492 CTGAGTCATGCACAGCAGCAGGG - Intronic
1057572632 9:96216146-96216168 CTCAGGCTTGTCCAGGAGGATGG + Intergenic
1061420458 9:130470649-130470671 CTGGGGCATGTCCAGCAATAGGG + Intronic
1187572869 X:20522521-20522543 CTGTGTCCTGTCCAGCAGCAAGG + Intergenic
1187762276 X:22601070-22601092 CTCAGGCAGGTCCATCAGGAGGG + Intergenic
1192381938 X:70626202-70626224 CTCAGTCAGGGCTAGGAGTAGGG + Intronic
1201558763 Y:15292572-15292594 CTCTTTCATTTCCAGCTGTAGGG + Intergenic