ID: 1150362123

View in Genome Browser
Species Human (GRCh38)
Location 17:64545235-64545257
Sequence ATGTTTCAACCTAGTCTAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 348}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150362123_1150362124 28 Left 1150362123 17:64545235-64545257 CCACTTAGACTAGGTTGAAACAT 0: 1
1: 0
2: 0
3: 9
4: 348
Right 1150362124 17:64545286-64545308 GAAAAACACAAACATGTAAATGG 0: 1
1: 0
2: 1
3: 110
4: 972

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150362123 Original CRISPR ATGTTTCAACCTAGTCTAAG TGG (reversed) Intronic
900015939 1:149933-149955 ATGTTACAACCTGTTCCAAGGGG + Intergenic
900046202 1:508530-508552 ATGTTACAACCTGTTCCAAGGGG + Intergenic
900068404 1:750242-750264 ATGTTACAACCTGTTCCAAGGGG + Intergenic
904711939 1:32436603-32436625 AAGTGTCTACCTAGACTAAGAGG - Intergenic
905500087 1:38429335-38429357 AAGTGTCTACCTAGACTAAGAGG - Intergenic
906744213 1:48210425-48210447 AAGTGTCTACCTAGACTAAGAGG + Intergenic
907503265 1:54899313-54899335 AAGTGTCTACCTAGACTAAGAGG + Intergenic
908461408 1:64351410-64351432 AAGTATCTACCTAGACTAAGAGG + Intergenic
909035775 1:70592555-70592577 AAGTGTCTACCTAGACTAAGAGG - Intergenic
909776374 1:79490016-79490038 AAGTGTCTACCTAGACTAAGAGG + Intergenic
909910269 1:81249720-81249742 AAGTATCTACCTAGACTAAGAGG - Intergenic
910517372 1:88077132-88077154 ATGTTTCTACCTACTCTGTGGGG - Intergenic
911570689 1:99513886-99513908 AAGTGTCTACCTAGACTAAGAGG - Intergenic
911878379 1:103199307-103199329 ATGTTTCAACATAGGCTATGGGG + Intergenic
912296770 1:108477204-108477226 AAGTGTCTACCTAGACTAAGAGG - Intergenic
915265257 1:154712245-154712267 ATTTTTAAACCTAGTCCCAGCGG + Intronic
916457646 1:164987258-164987280 GTGTTTGAATCTACTCTAAGTGG + Intergenic
921509582 1:216012424-216012446 AAGTGTCTACCTAGACTAAGAGG - Intronic
921955631 1:220980663-220980685 ATGTTTCTAACTAGTCAAAGTGG + Intergenic
922103763 1:222495628-222495650 ATGTTACAACCTGTTCCAAGGGG + Intergenic
922153759 1:223025851-223025873 AAGTATCTACCTAGACTAAGAGG + Intergenic
922264082 1:223968145-223968167 ATGTTACAACCTGTTCCAAGGGG + Intergenic
922905206 1:229168859-229168881 TTTTTTCAAGCTAGTCTGAGGGG + Intergenic
923257030 1:232231076-232231098 AAGTATCTACCTAGACTAAGAGG + Intergenic
923963095 1:239105626-239105648 AAGTGTCTACCTAGACTAAGAGG - Intergenic
924345929 1:243073137-243073159 ATGTTACAACCTGTTCCAAGGGG + Intergenic
924895809 1:248337127-248337149 AAGTGTCTACCTAGACTAAGAGG + Intergenic
1062804797 10:409892-409914 CTTTTACAACCTAGTCTCAGAGG + Intronic
1063363499 10:5475585-5475607 AAGTGTCAACCTAGACTAAGAGG - Intergenic
1063527380 10:6798541-6798563 AAGTGTCTACCTAGACTAAGAGG + Intergenic
1064130548 10:12705774-12705796 ATGGTTCGTGCTAGTCTAAGAGG + Intronic
1065442820 10:25770198-25770220 AAGTATCTACCTAGACTAAGAGG + Intergenic
1066730413 10:38431678-38431700 ATGTTACAACCTGTTCCAAGGGG - Intergenic
1068058042 10:52035211-52035233 AAGTATCTACCTAGACTAAGAGG + Intronic
1068231277 10:54171020-54171042 AAGTATCTACCTAGACTAAGAGG - Intronic
1068592032 10:58862461-58862483 AAGTATCTACCTAGACTAAGAGG + Intergenic
1071897435 10:90082483-90082505 AAGTATCTACCTAGACTAAGAGG + Intergenic
1071981874 10:91011541-91011563 ATGTTTCAACCTAATATTTGGGG - Intergenic
1075244301 10:120806952-120806974 TTGTTTTAACGTAGGCTAAGGGG + Intergenic
1076972531 11:145002-145024 ATGTTACAACCTGTTCCAAGGGG + Intergenic
1077612502 11:3652198-3652220 AAGTGTCTACCTAGACTAAGAGG - Intronic
1077766079 11:5161721-5161743 AAGTGTCTACCTAGACTAAGAGG + Intronic
1078947281 11:16083526-16083548 ATGCTCCTACCTATTCTAAGTGG - Intronic
1079726779 11:23888636-23888658 AAGTATCTACCTAGACTAAGAGG + Intergenic
1083025627 11:59548294-59548316 ATGTTTCAACCTTCTGTCAGAGG - Intergenic
1083132754 11:60641191-60641213 ATGGTTCAACCTAATACAAGGGG - Intergenic
1085552910 11:77391650-77391672 ATTTTACAACCTTGTCTACGAGG + Intronic
1086495838 11:87403825-87403847 ATGTTGCAGCCTAGCCTCAGTGG + Intergenic
1087167672 11:95021287-95021309 AAGTGTCTACCTAGACTAAGAGG + Intergenic
1088741888 11:112774135-112774157 AGGATTCAGCCAAGTCTAAGAGG - Intergenic
1089470749 11:118718457-118718479 AAGTGTCTACCTAGACTAAGAGG + Intergenic
1089987981 11:122831377-122831399 AAGTGTCTACCTAGACTAAGAGG - Intergenic
1091184013 11:133631262-133631284 AAGTGTCTACCTAGACTAAGAGG - Intergenic
1091204159 11:133808069-133808091 ATCCATCAACCTAGTTTAAGTGG + Intergenic
1092474793 12:8809184-8809206 AAGTGTCTACCTAGACTAAGAGG - Intergenic
1092626442 12:10334374-10334396 AAGTATCTACCTAGACTAAGAGG + Intergenic
1092636242 12:10453622-10453644 ATTTAGCAACCTAGTCTAAAAGG - Intronic
1092723430 12:11463630-11463652 AAGTATCTACCTAGACTAAGAGG + Intronic
1092790017 12:12062648-12062670 AAGTGTCTACCTAGACTAAGAGG - Intronic
1093321681 12:17721655-17721677 AAGTGTCTACCTAGACTAAGAGG + Intergenic
1094320782 12:29180529-29180551 ATCTTTCTAACTAGTTTAAGAGG - Intronic
1095638006 12:44454605-44454627 AAGTGTCTACCTAGACTAAGAGG - Intergenic
1095689798 12:45074998-45075020 AAGTTTCTACCCTGTCTAAGAGG - Intergenic
1098566807 12:71946326-71946348 AATTTTCAAACTAGACTAAGGGG - Intronic
1098629363 12:72707613-72707635 AAGTATCTACCTAGACTAAGAGG - Intergenic
1099291792 12:80784531-80784553 AAGTGTCTACCTAGACTAAGAGG + Intergenic
1101278093 12:103224132-103224154 AAGTATCTACCTAGACTAAGAGG + Intergenic
1102096686 12:110246815-110246837 ATCTTTCATCCTAGTGGAAGGGG + Intergenic
1103157624 12:118699967-118699989 ATGTTTGAACATTTTCTAAGAGG - Intergenic
1107075884 13:36320709-36320731 AAGTGTCTACCTAGACTAAGAGG - Intronic
1108803536 13:54128828-54128850 AAGTGTCTACCTAGACTAAGAGG + Intergenic
1108913117 13:55579690-55579712 AAGTATCTACCTAGACTAAGAGG + Intergenic
1108919244 13:55656411-55656433 AAGTATCTACCTAGACTAAGAGG + Intergenic
1109215436 13:59584392-59584414 ATGGTTCAACCTAGTAGAAGGGG - Intergenic
1109343931 13:61093001-61093023 AAGTGTCTACCTAGACTAAGAGG - Intergenic
1109499606 13:63217373-63217395 AAGTGTCTACCTAGACTAAGAGG - Intergenic
1109709362 13:66142778-66142800 AAGTGTCTACCTAGACTAAGAGG + Intergenic
1110765788 13:79278403-79278425 AAGTGTCTACCTAGACTAAGAGG - Intergenic
1111302352 13:86362672-86362694 AAGTATCTACCTAGACTAAGAGG - Intergenic
1111611974 13:90616690-90616712 CTGTGTCATCCCAGTCTAAGGGG + Intergenic
1111657367 13:91170607-91170629 ATGTTTCAGCCTAGTAGAGGTGG + Intergenic
1112237166 13:97646771-97646793 AAGTGTCTACCTAGACTAAGAGG - Intergenic
1113905819 13:113818769-113818791 GGACTTCAACCTAGTCTAAGAGG - Intergenic
1114505615 14:23210177-23210199 ATGATTCAACTTAGTCATAGGGG - Intronic
1115442200 14:33448739-33448761 ACGTTTCATCCTTGTCTCAGGGG - Intronic
1115905111 14:38195041-38195063 AAGTATCTACCTAGACTAAGAGG - Intergenic
1116534470 14:46013871-46013893 AAGTGTCTACCTAGACTAAGAGG + Intergenic
1116702056 14:48256616-48256638 AAGTGTCTACCTAGACTAAGAGG + Intergenic
1116702990 14:48263815-48263837 AAGTGTCTACCTAGACTAAGAGG + Intergenic
1117957574 14:61134656-61134678 AAGTGTCTACCTAGACTAAGAGG + Intergenic
1118521171 14:66587362-66587384 ATCTTTCAAACTATTTTAAGAGG + Intronic
1119753870 14:77099836-77099858 ACGTTTCAACTTAGAATAAGGGG + Intronic
1121163181 14:91764767-91764789 ATGTTTTAATCTAGTGTAAATGG - Intronic
1122041299 14:98989459-98989481 AAGTATCTACCTAGACTAAGAGG - Intergenic
1126844173 15:52743749-52743771 AAGTGTCTACCTAGACTAAGAGG - Intergenic
1128645577 15:69376537-69376559 ATGTTCCAGCTTAGACTAAGAGG - Intronic
1131684491 15:94755033-94755055 AAGTGTCTACCTAGACTAAGAGG - Intergenic
1131882204 15:96873267-96873289 AAGTGTCTACCTAGACTAAGAGG + Intergenic
1134822151 16:17255648-17255670 CTGTTTCACCCTTGTCTAAGTGG - Intronic
1135636567 16:24080931-24080953 ATTTTTCAACCTATTTTATGAGG + Intronic
1138605498 16:58085879-58085901 AAGTTTCAAAATAGTCTAAAAGG + Intergenic
1138805253 16:60083092-60083114 AAGTGTCTACCTAGACTAAGAGG - Intergenic
1139942748 16:70617928-70617950 AAGTATCTACCTAGACTAAGAGG + Intronic
1142447720 16:90152519-90152541 ATGTTACAACCTGTTCCAAGGGG - Intergenic
1142459770 17:82804-82826 ATGTTACAACCTGTTCCAAGGGG + Intergenic
1150362123 17:64545235-64545257 ATGTTTCAACCTAGTCTAAGTGG - Intronic
1151839447 17:76607406-76607428 AAGTGTCTACCTAGACTAAGAGG + Intergenic
1156251592 18:35357563-35357585 AAGTATCTACCTAGACTAAGAGG + Intergenic
1156938830 18:42740913-42740935 AAGTGTCTACCTAGACTAAGAGG - Intergenic
1157906087 18:51571485-51571507 AAGTGTCTACCTAGACTAAGAGG + Intergenic
1157950512 18:52031731-52031753 ATGTTGCAACCAAAGCTAAGGGG - Intergenic
1158336676 18:56419858-56419880 AAGTATCTACCTAGACTAAGAGG - Intergenic
1160355073 18:78220929-78220951 ATGTATCAACTTAGTTTTAGAGG + Intergenic
1160649486 19:215312-215334 ATGTTACAACCTGTTCCAAGGGG + Intergenic
1163487596 19:17597689-17597711 AAGTGTCTACCTAGACTAAGAGG - Intergenic
1163907479 19:20159798-20159820 AAGTGTCTACCTAGACTAAGAGG - Intergenic
1165835668 19:38753872-38753894 AAGTGTCTACCTAGACTAAGAGG - Intronic
1168227679 19:55008245-55008267 AAGTGTCTACCTAGACTAAGAGG + Intergenic
925544856 2:5005245-5005267 AAGTATCTACCTAGACTAAGAGG - Intergenic
925828523 2:7874148-7874170 AAGTATCTACCTAGACTAAGAGG + Intergenic
926463784 2:13165455-13165477 AAGTGTCTACCTAGACTAAGAGG + Intergenic
928827324 2:35438335-35438357 AAGTGTCTACCTAGACTAAGAGG + Intergenic
930183003 2:48383718-48383740 ATGTATCATACTAGTATAAGAGG + Intergenic
931042923 2:58317960-58317982 AAGTGTCTACCTAGACTAAGAGG - Intergenic
931608637 2:64076628-64076650 AAGTGTCTACCTAGACTAAGAGG + Intergenic
931960203 2:67473881-67473903 ATGTTTTAATCTAGTGTAAAAGG + Intergenic
932853903 2:75215190-75215212 AAGTATCTACCTAGACTAAGAGG + Intergenic
932973611 2:76575087-76575109 AAGTATCTACCTAGACTAAGAGG + Intergenic
933013396 2:77092640-77092662 AAGTATCTACCTAGACTAAGAGG - Intronic
933079573 2:77969368-77969390 AAGTATCTACCTAGACTAAGAGG - Intergenic
933164026 2:79055638-79055660 AAGTGTCTACCTAGACTAAGAGG - Intergenic
933179418 2:79212745-79212767 AAGTGTCTACCTAGACTAAGAGG + Intronic
933552098 2:83790357-83790379 AAGTATCTACCTAGACTAAGAGG + Intergenic
937692356 2:124770748-124770770 ATTTTTCAACCTAGGCAAATTGG - Intronic
939063906 2:137459106-137459128 AATTTTCAAACTAGTATAAGAGG - Intronic
939082842 2:137684388-137684410 AAGTGTCTACCTAGACTAAGAGG + Intergenic
939307776 2:140430958-140430980 AAGTGTCTACCTAGACTAAGAGG - Intronic
939504942 2:143033595-143033617 ATGTTTAAACAGATTCTAAGTGG - Intronic
940426391 2:153535968-153535990 AAGTATCTACCTAGACTAAGAGG + Intergenic
940716649 2:157233426-157233448 ATGTTTAATCAAAGTCTAAGAGG - Intergenic
943950967 2:194132121-194132143 AAGTGTCTACCTAGACTAAGAGG + Intergenic
945173808 2:207021883-207021905 AAGTGTCTACCTAGACTAAGAGG - Intergenic
945301114 2:208217305-208217327 AAGTGTCTACCTAGACTAAGAGG + Intergenic
945650380 2:212551259-212551281 ATGTTTCATCCTAATGAAAGAGG + Intergenic
948390998 2:237611212-237611234 AAGTGTCTACCTAGACTAAGAGG - Intergenic
1170068560 20:12341719-12341741 AAGTATCTACCTAGACTAAGAGG + Intergenic
1170325152 20:15149061-15149083 AAGTGTCTACCTAGACTAAGAGG + Intronic
1172932111 20:38593821-38593843 AAGTGTCTACCTAGACTAAGAGG + Intergenic
1173782027 20:45763924-45763946 AAGTGTCTACCTAGACTAAGAGG - Intronic
1175450939 20:59067389-59067411 ATGTTTCAGTCTAGGCTGAGAGG - Intergenic
1177840407 21:26229260-26229282 AAGTGTCTACCTAGACTAAGAGG + Intergenic
1178001504 21:28165467-28165489 AAGTGTCTACCTAGACTAAGAGG - Intergenic
1178931575 21:36823548-36823570 ATGTGTGAACTTAGTCTACGAGG + Intronic
1182765593 22:32755786-32755808 TTGTTTCAACATAGTACAAGGGG - Intronic
949671470 3:6401943-6401965 AAGTGTCTACCTAGACTAAGAGG - Intergenic
949827747 3:8181273-8181295 AAGTGTCTACCTAGACTAAGAGG - Intergenic
951315980 3:21190431-21190453 AAGTGTCTACCTAGACTAAGAGG + Intergenic
953076824 3:39579253-39579275 AAGTGTCTACCTAGACTAAGAGG + Intergenic
953177502 3:40565236-40565258 AAGTGTCTACCTAGACTAAGAGG - Intronic
955581047 3:60422837-60422859 ATTCTTCAACCTAGTTTAAATGG + Intronic
955641050 3:61084624-61084646 ATATTTCAAGCTATTTTAAGTGG + Intronic
955666852 3:61358474-61358496 ATTTTTTAACCTAATCTCAGTGG - Intergenic
957317005 3:78584588-78584610 AAGTATCTACCTAGACTAAGAGG + Intergenic
957346986 3:78974254-78974276 ATGTTTCAACAATGTCAAAGAGG + Intronic
960016590 3:112897055-112897077 ATGTTTTAAGCTAGGGTAAGAGG + Intergenic
960309820 3:116106765-116106787 AAGTGTCTACCTAGACTAAGAGG + Intronic
960384919 3:117011305-117011327 ATGTTTCAATTTAGTCTCAAAGG + Intronic
961095799 3:124155517-124155539 ATATTTAAACCTAGTCTGTGGGG - Intronic
962205896 3:133433547-133433569 AAGTGTCTACCTAGACTAAGAGG - Intronic
963424822 3:145112686-145112708 AAGTGTCTACCTAGACTAAGAGG + Intergenic
963456364 3:145552639-145552661 AAGTGTCTACCTAGACTAAGAGG + Intergenic
964125085 3:153227573-153227595 AAGTGTCTACCTAGACTAAGAGG + Intergenic
964906228 3:161723333-161723355 AAGTGTCTACCTAGACTAAGAGG + Intergenic
965104939 3:164343578-164343600 AAGTGTCTACCTAGACTAAGAGG + Intergenic
965286433 3:166825545-166825567 AAGTGTCTACCTAGACTAAGAGG + Intergenic
965626017 3:170684779-170684801 AAGTGTCTACCTAGACTAAGAGG + Intronic
965639673 3:170819030-170819052 AAGTATCTACCTAGACTAAGAGG + Intronic
965893379 3:173542648-173542670 TTCTTTTAACCTAGTATAAGTGG + Intronic
966067238 3:175832771-175832793 AAGTGTCTACCTAGACTAAGAGG - Intergenic
966104796 3:176323085-176323107 AAGTATCTACCTAGACTAAGAGG + Intergenic
967243873 3:187467719-187467741 AAGTGTCTACCTAGACTAAGAGG + Intergenic
967496527 3:190148763-190148785 AAGTGTCTACCTAGACTAAGAGG - Intergenic
967561686 3:190924374-190924396 AAGTGTCTACCTAGACTAAGAGG - Intergenic
967624317 3:191667723-191667745 AAGTATCTACCTAGACTAAGAGG + Intergenic
967643517 3:191896789-191896811 AAGTGTCTACCTAGACTAAGAGG + Intergenic
967740769 3:192999949-192999971 AAGTATCTACCTAGACTAAGAGG - Intergenic
968778479 4:2560408-2560430 ATGTTCCAATCCAGTCTAAGTGG - Intronic
969381846 4:6805720-6805742 ATGTTTCAACGTTGACAAAGTGG + Intronic
970263055 4:14250052-14250074 ATGTTTGGACCTAGCCAAAGAGG + Intergenic
970438526 4:16059139-16059161 ATGTAATAGCCTAGTCTAAGAGG + Intronic
970467563 4:16342260-16342282 ATCTTTCAATATAATCTAAGGGG + Intergenic
970805845 4:20031235-20031257 ATATATTAACATAGTCTAAGAGG - Intergenic
970848794 4:20576401-20576423 ATGTTTCAAAGTAGTGTATGGGG - Intronic
972622657 4:40763497-40763519 ATGTCTGAACTTAGTCTCAGAGG + Intronic
973052337 4:45611073-45611095 GTGCTCCAACCCAGTCTAAGGGG + Intergenic
974904202 4:68035790-68035812 AAGTGTCTACCTAGACTAAGAGG - Intergenic
974950646 4:68580317-68580339 GTGTTCTAACCCAGTCTAAGGGG + Intronic
975181844 4:71355094-71355116 ATGTTTTAACCTGTTCTAACTGG + Intronic
975933583 4:79555423-79555445 AAGTATCTACCTAGACTAAGAGG + Intergenic
976697864 4:87937382-87937404 AAGTATCTACCTAGACTAAGAGG + Intergenic
976884259 4:89966207-89966229 AAGTGTCTACCTAGACTAAGAGG + Intergenic
977010610 4:91628340-91628362 AAGTGTCTACCTAGACTAAGAGG - Intergenic
977012623 4:91656067-91656089 AAGTGTCTACCTAGACTAAGAGG + Intergenic
977074901 4:92440417-92440439 AAGTGTCTACCTAGACTAAGAGG + Intronic
977198130 4:94086076-94086098 AAGTATCTACCTAGACTAAGAGG + Intergenic
979054315 4:115977114-115977136 AAGTGTCTACCTAGACTAAGAGG + Intergenic
979146912 4:117256352-117256374 AAGTGTCTACCTAGACTAAGAGG - Intergenic
979256788 4:118614542-118614564 ATGTTACAACCTGTTCCAAGGGG - Intergenic
979331561 4:119426003-119426025 ATGTTACAACCTGTTCCAAGGGG + Intergenic
979341155 4:119525895-119525917 ATGGTTCAAAGTAGGCTAAGTGG + Intronic
979824403 4:125215664-125215686 ATGTTTTAACATAGCCCAAGTGG + Intergenic
980040628 4:127935381-127935403 ATGTTGCATCCTAGACTATGGGG + Intronic
980258637 4:130417624-130417646 GTTTTTCAACCTAGTTTAATAGG + Intergenic
980370075 4:131857711-131857733 CTGTTGCAACCTAGTATAATGGG + Intergenic
980389223 4:132122454-132122476 AAGTGTCTACCTAGACTAAGAGG - Intergenic
980575330 4:134679359-134679381 AAGTGTCTACCTAGACTAAGAGG + Intergenic
980904245 4:138932128-138932150 AAGTGTCTACCTAGACTAAGAGG - Intergenic
981540020 4:145837010-145837032 AAGTATCTACCTAGACTAAGAGG - Intronic
982083651 4:151813893-151813915 AAGTGTCTACCTAGACTAAGAGG + Intergenic
982396360 4:154919745-154919767 AAGTGTCTACCTAGACTAAGAGG + Intergenic
982413865 4:155109734-155109756 AAGTGTCTACCTAGACTAAGAGG + Intergenic
982496817 4:156104930-156104952 AAGTGTCTACCTAGACTAAGAGG + Intergenic
982535746 4:156604547-156604569 AAGTATCTACCTAGACTAAGAGG - Intergenic
983360716 4:166720568-166720590 AAGTATCTACCTAGACTAAGAGG - Intergenic
983659877 4:170120712-170120734 AAGTGTCTACCTAGACTAAGAGG - Intergenic
984098707 4:175462633-175462655 AAGTGTCTACCTAGACTAAGAGG + Intergenic
984437669 4:179725457-179725479 AAGTGTCTACCTAGACTAAGAGG - Intergenic
985057059 4:186045436-186045458 AAGTGTCTACCTAGACTAAGAGG + Intergenic
986193827 5:5519803-5519825 AAGTGTCTACCTAGACTAAGAGG - Intergenic
986389176 5:7267848-7267870 AAGTGTCTACCTAGACTAAGAGG - Intergenic
986919280 5:12663983-12664005 AAGTATCTACCTAGACTAAGAGG + Intergenic
987282300 5:16423982-16424004 AAGTGTCTACCTAGACTAAGAGG - Intergenic
987497827 5:18670305-18670327 AAGTGTCTACCTAGACTAAGAGG + Intergenic
987756129 5:22099105-22099127 AAGTGTCTACCTAGACTAAGAGG - Intronic
992394968 5:76361595-76361617 AAGTATCTACCTAGACTAAGAGG - Intergenic
992685801 5:79198300-79198322 ATGTATCAACCAAGAATAAGGGG - Intronic
993037758 5:82775714-82775736 AAGATTCAACCTATTCTATGTGG - Intergenic
994557218 5:101319169-101319191 AAGTGTCTACCTAGACTAAGAGG - Intergenic
994775979 5:104035872-104035894 AAGTGTCTACCTAGACTAAGAGG - Intergenic
994989846 5:106982629-106982651 AAGTATCTACCTAGACTAAGAGG - Intergenic
995122810 5:108553540-108553562 AAGTATCTACCTAGTCTAAGAGG - Intergenic
996358319 5:122620333-122620355 AAGTGTCAACCCAGACTAAGAGG + Intergenic
996510198 5:124308042-124308064 AAGTGTCTACCTAGACTAAGAGG - Intergenic
996528347 5:124501311-124501333 AAGTGTCTACCTAGACTAAGAGG - Intergenic
996745097 5:126840791-126840813 AAGTATCTACCTAGACTAAGAGG + Intergenic
998051529 5:139040115-139040137 ATCTTTAAACCTAGCCTATGTGG - Intronic
998693392 5:144612763-144612785 AAGTGTCTACCTAGACTAAGAGG + Intergenic
998995687 5:147867548-147867570 AAGTGTCTACCTAGACTAAGAGG - Intergenic
999595201 5:153195555-153195577 AAGTTTACACCTGGTCTAAGAGG + Intergenic
1000474633 5:161690720-161690742 ATGGTTCAACCTAATAAAAGGGG - Intronic
1000519097 5:162276851-162276873 AAGTGTCTACCTAGACTAAGAGG + Intergenic
1001331149 5:170763493-170763515 AAGTGTCTACCTAGACTAAGAGG + Intronic
1002300554 5:178255215-178255237 CTGTTTCCACCTGGTCTGAGGGG + Intronic
1002727582 5:181310046-181310068 ATGTTACAACCTGTTCCAAGGGG - Intergenic
1003968439 6:11275936-11275958 ATGTTTCAACCTCCTCAAACGGG + Intronic
1004106565 6:12671621-12671643 AAGTGTCTACCTAGACTAAGAGG - Intergenic
1004283217 6:14298405-14298427 AAGTGTCTACCTAGACTAAGAGG + Intergenic
1004507694 6:16260440-16260462 AAGTGTCTACCTAGACTAAGAGG + Intronic
1004575530 6:16890208-16890230 AAGTGTCTACCTAGACTAAGAGG - Intergenic
1004768274 6:18755547-18755569 AAGTGTCTACCTAGACTAAGAGG + Intergenic
1004787935 6:18989684-18989706 ATGTTTCATCCCACTCTTAGTGG + Intergenic
1005014349 6:21362955-21362977 AAGTATCTACCTAGACTAAGAGG + Intergenic
1010829341 6:80511205-80511227 AAGTGTCTACCTAGACTAAGAGG + Intergenic
1011850680 6:91624206-91624228 TTTTCTCAACCTAGACTAAGAGG + Intergenic
1012014093 6:93831521-93831543 AAGTGTCTACCTAGACTAAGAGG + Intergenic
1013892011 6:115036139-115036161 AAGTATCTACCTAGACTAAGAGG - Intergenic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1014359862 6:120463727-120463749 AAGTATCTACCTAGACTAAGAGG + Intergenic
1014396373 6:120929433-120929455 AAGTGTCTACCTAGACTAAGAGG - Intergenic
1014556148 6:122844086-122844108 AAGTATCTACCTAGACTAAGAGG - Intergenic
1014793686 6:125703314-125703336 AAGTATCTACCTAGACTAAGAGG + Intergenic
1015165541 6:130196790-130196812 AAGTGTCTACCTAGACTAAGAGG - Intronic
1015267047 6:131299711-131299733 AAGTGTCTACCTAGACTAAGAGG - Intergenic
1015269948 6:131327656-131327678 AAGTGTCTACCTAGACTAAGAGG - Intergenic
1015324129 6:131905945-131905967 AAGTGTCTACCTAGACTAAGAGG - Intergenic
1016113843 6:140258899-140258921 AAGTGTCTACCTAGACTAAGAGG + Intergenic
1016624210 6:146146575-146146597 AAGTTTCAACATAGTTTCAGAGG - Intronic
1016853576 6:148644063-148644085 AAGTGTCTACCTAGACTAAGAGG - Intergenic
1018084192 6:160288025-160288047 AAGTGTCTACCTAGACTAAGAGG + Intergenic
1018183498 6:161244791-161244813 GTGTTTCATCCTAGGCTAAGTGG - Intronic
1018495094 6:164340187-164340209 AAGTGTCTACCTAGACTAAGAGG + Intergenic
1018521167 6:164653605-164653627 AAGTGTCTACCTAGACTAAGAGG + Intergenic
1018847643 6:167566533-167566555 CTTGTTCAACCTAGTTTAAGAGG - Intergenic
1020532409 7:9354869-9354891 AAGTATCTACCTAGACTAAGAGG + Intergenic
1021637691 7:22707881-22707903 AAGTGTCTACCTAGACTAAGAGG - Intergenic
1021810953 7:24400534-24400556 AAGTATCTACCTAGACTAAGAGG - Intergenic
1023398769 7:39775840-39775862 ATGTTACAACCTGTTCCAAGGGG - Intergenic
1023698584 7:42872060-42872082 AAGTATCTACCTAGACTAAGAGG + Intergenic
1024351269 7:48367328-48367350 ATATTTCAACCCACTCTAACTGG - Intronic
1024651670 7:51408848-51408870 ATGTTACAACCTGTTCCAAGGGG + Intergenic
1025133876 7:56394650-56394672 ATGTTACAACCTGTTCCAAGGGG + Intergenic
1027852256 7:83463926-83463948 AAGTATCTACCTAGACTAAGAGG - Intronic
1028670806 7:93398193-93398215 AAGTGTCTACCTAGACTAAGAGG - Intergenic
1030441356 7:109593275-109593297 AAGTGTCTACCTAGACTAAGAGG + Intergenic
1031134150 7:117867649-117867671 ATGTTTCAGCCCACTCTAGGGGG + Intronic
1031354831 7:120778028-120778050 AAGTGTCTACCTAGACTAAGAGG + Intergenic
1031364465 7:120887081-120887103 AAGTGTCTACCTAGACTAAGAGG + Intergenic
1031400281 7:121319819-121319841 AAGTGTCTACCTAGACTAAGAGG - Intergenic
1031422111 7:121565060-121565082 AAGTGTCTACCTAGACTAAGAGG + Intergenic
1031662172 7:124438865-124438887 AAGTTTATACCTAGTCTATGAGG + Intergenic
1031686147 7:124733290-124733312 AAGTGTCTACCTAGACTAAGAGG - Intergenic
1031727641 7:125260354-125260376 AAGTATCTACCTAGACTAAGAGG + Intergenic
1031776617 7:125914255-125914277 AAGTATCTACCTAGACTAAGAGG - Intergenic
1032049097 7:128635313-128635335 ATGTTACAACCTGTTCCAAGGGG - Intergenic
1033028206 7:137798322-137798344 ACCTTTCAACCTACTCTACGTGG + Intronic
1033909168 7:146244832-146244854 AAGTGTCTACCTAGGCTAAGAGG + Intronic
1036142946 8:6225266-6225288 ATATTTCAACCGTGTATAAGAGG - Intergenic
1036281779 8:7406691-7406713 AAGTATCTACCTAGACTAAGAGG - Intergenic
1036339691 8:7904880-7904902 AAGTATCTACCTAGACTAAGAGG + Intergenic
1037866477 8:22447675-22447697 AACTTTCAACCTAACCTAAGTGG + Intronic
1038747991 8:30270802-30270824 AAGCTTCACCCTCGTCTAAGAGG - Intergenic
1043271039 8:78333958-78333980 TTGTTTAATCCTAGTTTAAGAGG + Intergenic
1044148219 8:88743664-88743686 AAGTGTCTACCTAGACTAAGAGG + Intergenic
1044925460 8:97205182-97205204 AAGTATCTACCTAGACTAAGAGG - Intergenic
1045491527 8:102673165-102673187 ATGTTTTAACCTAGTCATTGGGG + Intergenic
1046294425 8:112200087-112200109 AAGTGTCTACCTAGACTAAGAGG - Intergenic
1046386046 8:113510961-113510983 AAGTATCTACCTAGACTAAGAGG + Intergenic
1046440313 8:114245600-114245622 AAGTATCTACCTAGACTAAGAGG - Intergenic
1046443553 8:114286252-114286274 AAGTATCTACCTAGACTAAGAGG - Intergenic
1046512383 8:115216490-115216512 AAGTATCTACCTAGACTAAGAGG - Intergenic
1046519984 8:115311575-115311597 ATGGTTCAATCTAATGTAAGTGG - Intergenic
1047264449 8:123292867-123292889 CTTCTTCAAACTAGTCTAAGGGG - Intergenic
1047699654 8:127435982-127436004 AAGTATCTACCTAGACTAAGAGG - Intergenic
1047829242 8:128613362-128613384 AAGTATCTACCTAGACTAAGAGG + Intergenic
1047995251 8:130328949-130328971 ATATTTCCTGCTAGTCTAAGAGG - Intronic
1048097897 8:131314462-131314484 AAGTGTCTACCTAGACTAAGAGG - Intergenic
1048168135 8:132081680-132081702 AAGTGTCTACCTAGACTAAGAGG + Intronic
1051052936 9:12952607-12952629 AAGTATCTACCTAGACTAAGAGG - Intergenic
1052192191 9:25673736-25673758 AAGTGTCTACCTAGACTAAGAGG - Intergenic
1055233370 9:74089923-74089945 AAGTATCTACCTAGACTAAGAGG - Intergenic
1056522748 9:87415189-87415211 AAGTGTCTACCTAGACTAAGAGG - Intergenic
1056883275 9:90416840-90416862 AAGTATCTACCTAGACTAAGAGG - Intergenic
1059606404 9:115840645-115840667 AAGTATCTACCTAGACTAAGAGG + Intergenic
1059863155 9:118486908-118486930 AAGTATCTACCTAGACTAAGAGG + Intergenic
1061567546 9:131452927-131452949 ATGTTCCAACTTAGTCAAGGTGG + Intronic
1062752701 9:138267524-138267546 ATGTTACAACCTGTTCCAAGGGG - Intergenic
1203575219 Un_KI270745v1:2299-2321 ATGTTACAACCTGTTCCAAGGGG - Intergenic
1185991368 X:4895844-4895866 AAGTGTCTACCTAGACTAAGAGG - Intergenic
1186112551 X:6273635-6273657 AAGTGTCTACCTAGACTAAGAGG + Intergenic
1186784384 X:12944093-12944115 AAGTGTCTACCTAGACTAAGAGG - Intergenic
1188463053 X:30450354-30450376 AAGTGTCTACCTAGACTAAGAGG + Intergenic
1188501052 X:30826529-30826551 TTGTTTCAACATAATCTAGGGGG + Intergenic
1193886228 X:86986065-86986087 AAGTGTCTACCTAGACTAAGAGG - Intergenic
1193941800 X:87686157-87686179 AAGTATCTACCTAGACTAAGAGG - Intergenic
1194308240 X:92274519-92274541 AAGTGTCTACCTAGACTAAGAGG + Intronic
1194502679 X:94700270-94700292 AAGTATCTACCTAGACTAAGAGG + Intergenic
1194873401 X:99160135-99160157 AAGTGTCTACCTAGACTAAGAGG + Intergenic
1195841798 X:109182681-109182703 AAGTGTCTACCTAGACTAAGAGG - Intergenic
1196153143 X:112396536-112396558 ATGTCTAAAACTAGTCTAGGAGG - Intergenic
1196165847 X:112534873-112534895 AAGTATCTACCTAGACTAAGAGG - Intergenic
1196194937 X:112829604-112829626 ATTTTTCAACCTAATCTAATAGG - Intronic
1196331128 X:114471025-114471047 AAGTATCTACCTAGACTAAGAGG - Intergenic
1196341416 X:114602743-114602765 AAGTATCTACCTAGACTAAGAGG + Intronic
1196533251 X:116813937-116813959 AAGTATCTACCTAGACTAAGAGG + Intergenic
1197065210 X:122226299-122226321 AAGTATCTACCTAGACTAAGAGG - Intergenic
1197701052 X:129599929-129599951 ATGTTACAGCCTAGGCTAGGAGG - Intergenic
1198598750 X:138263066-138263088 AAGTGTCTACCTAGACTAAGAGG - Intergenic
1198599094 X:138265767-138265789 AAGTGTCTACCTAGACTAAGAGG + Intergenic