ID: 1150365824

View in Genome Browser
Species Human (GRCh38)
Location 17:64583255-64583277
Sequence ATGCTGTCATTGTAGCTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150365824_1150365827 25 Left 1150365824 17:64583255-64583277 CCCTGGAGCTACAATGACAGCAT 0: 1
1: 0
2: 0
3: 13
4: 160
Right 1150365827 17:64583303-64583325 TCACTTTTAAAAAATAACAATGG 0: 1
1: 0
2: 8
3: 147
4: 1332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150365824 Original CRISPR ATGCTGTCATTGTAGCTCCA GGG (reversed) Intronic
900867713 1:5280280-5280302 ATGCAGTCATGATAGCACCAAGG - Intergenic
900900697 1:5513733-5513755 AGGCTGTGTCTGTAGCTCCATGG + Intergenic
904306095 1:29591308-29591330 ATGTTGTAAATGTCGCTCCAGGG + Intergenic
907029788 1:51159435-51159457 ATCCTGTCATTGCAGCAACATGG - Intergenic
910476811 1:87616272-87616294 GTGCTGTCATTTGAGCACCACGG + Intergenic
915349192 1:155213934-155213956 ATGCTGACACTGCTGCTCCACGG + Intergenic
915352379 1:155234561-155234583 ATGCTGACACTGCTGCTCCACGG + Exonic
916815434 1:168347515-168347537 ATGCTTTTATTGTAGATGCAGGG + Intergenic
917989101 1:180354305-180354327 AAACTGACATTGTAGCTTCAGGG - Intronic
918131766 1:181635682-181635704 ATGCTGACACTGCAGGTCCAGGG + Intronic
920247017 1:204595826-204595848 ATGCTGAGATTCTAGCTACAAGG - Intergenic
920965552 1:210697972-210697994 ATGCTATCATTGTAGGTATATGG + Intronic
921181609 1:212636145-212636167 AGGCTTTCATTGTGGCCCCACGG - Intergenic
1063062142 10:2567134-2567156 AGCCTGTGATTGCAGCTCCAGGG + Intergenic
1064152052 10:12873471-12873493 ATGCTGCCTTAGCAGCTCCAAGG - Intergenic
1065882462 10:30048246-30048268 AAGCAGTCATTGCAGCTCCCAGG - Intronic
1067219694 10:44335108-44335130 ATGCTGACCATGCAGCTCCATGG - Intergenic
1069738088 10:70670598-70670620 AAGCAATCATTGTAGCCCCAGGG + Intergenic
1070444988 10:76489667-76489689 CTGCTGTCATGGTATCTCCTAGG + Intronic
1071986032 10:91051319-91051341 AAGCAGTCTTTGGAGCTCCAAGG - Intergenic
1073598145 10:104820072-104820094 AAGCTGTCATGGTAACTTCAGGG + Intronic
1073666409 10:105539141-105539163 ATGCTGGGTTTGTAGCACCATGG + Intergenic
1073706820 10:105993107-105993129 ATCCTGTCATTGCAGCAACATGG + Intergenic
1074911717 10:117916144-117916166 ATTCTGTCATTGCAGCAACATGG + Intergenic
1075654269 10:124151058-124151080 CTGCTGTCATTGTGGTTCCCAGG - Intergenic
1078022436 11:7666783-7666805 AGGCGGTCACTGCAGCTCCATGG - Intronic
1078199500 11:9167441-9167463 ATGCTCTTCTTATAGCTCCAGGG + Intronic
1079505135 11:21144782-21144804 ATGCTGTAATTGGAGATCCAGGG + Intronic
1080317828 11:30970379-30970401 GAGATGTCAATGTAGCTCCATGG - Intronic
1084235486 11:67785576-67785598 ATTCTGCTATTGTAGCTCAAAGG - Intergenic
1084499181 11:69524914-69524936 CTGCTGTCATGGAAGCCCCAAGG + Intergenic
1085907019 11:80775703-80775725 GTGTTGTAATTGTAGTTCCATGG - Intergenic
1085976830 11:81665987-81666009 ATCCTGTCATAGTAGCTTCATGG - Intergenic
1088554142 11:111044477-111044499 ATCCTGTCTTTGTAGCAACATGG - Intergenic
1089875700 11:121719706-121719728 ATGCTGTCATTGGAGAACCAGGG - Intergenic
1091086720 11:132728041-132728063 ATGCTGTTCTTGAAGCTCCCTGG - Intronic
1096881367 12:54675326-54675348 GTGCTGGCCTTGTGGCTCCAGGG + Intergenic
1099960184 12:89389540-89389562 ATGCTGTAATTGAAGCTACCTGG - Intergenic
1101423534 12:104568601-104568623 CCGCTGTCATTGTATCTCTAGGG - Intronic
1103583323 12:121932826-121932848 ATGCATTCAATGAAGCTCCAAGG - Intronic
1104132836 12:125910918-125910940 ATGCTGCAATTCCAGCTCCAAGG + Intergenic
1105429140 13:20321236-20321258 AGGCTGTCCTCGTTGCTCCAAGG - Intergenic
1105465420 13:20635354-20635376 ATCCTGTCTTTATATCTCCATGG - Intronic
1107177699 13:37418972-37418994 ATTCTGTCATTCTGGCTGCAGGG + Intergenic
1111913836 13:94340402-94340424 ATGATTTTAATGTAGCTCCATGG - Intronic
1111918673 13:94388003-94388025 ATGCAGTTATTGTTGATCCAGGG + Intronic
1113652257 13:112042318-112042340 ATGCTGTCATAGTCCCTCCCAGG + Intergenic
1115184718 14:30672832-30672854 ATGCTGTCTTTGTAGTTGCATGG + Intronic
1115358003 14:32470047-32470069 ATGATGTCATATTAGATCCAGGG + Intronic
1116967005 14:51025382-51025404 ATCCTGTGATTACAGCTCCATGG - Intronic
1119616285 14:76101078-76101100 ATGCTTTCATAGGTGCTCCATGG + Intergenic
1120255545 14:82114726-82114748 ATGCTAGCTTTGTTGCTCCATGG - Intergenic
1130581631 15:85142601-85142623 AAGCTGTCATTATAGCTGCTGGG - Intergenic
1132871862 16:2118921-2118943 GTGCTGTCAGGGTGGCTCCAGGG - Intronic
1133127921 16:3658123-3658145 TGGCTGTCAGTGTCGCTCCAGGG + Exonic
1133463753 16:6009985-6010007 ATTCCGTCAGTGGAGCTCCATGG + Intergenic
1134520665 16:14917975-14917997 GTGCTGTCAGGGTGGCTCCAGGG + Intronic
1134550910 16:15137999-15138021 GTGCTGTCAGGGTGGCTCCAGGG - Intronic
1134708337 16:16316626-16316648 GTGCTGTCAGGGTGGCTCCAGGG + Intergenic
1134715552 16:16356659-16356681 GTGCTGTCAGGGTGGCTCCAGGG + Intergenic
1134951265 16:18352019-18352041 GTGCTGTCAGGGTGGCTCCAGGG - Intergenic
1134959205 16:18395500-18395522 GTGCTGTCAGGGTGGCTCCAGGG - Intergenic
1138433799 16:56985956-56985978 ATTCTGTCATTGTAGCATCAAGG - Intergenic
1139353507 16:66352980-66353002 AAGCTGGCATTTTAGCTCCATGG - Intergenic
1140041454 16:71411152-71411174 ATGCTGTAATTCTAGCTACTTGG - Intergenic
1140785224 16:78335010-78335032 ATGCTGACACTGCAGGTCCAGGG - Intronic
1142970338 17:3607005-3607027 ATGCTGTCATTGCAGCCCTGAGG - Intergenic
1144602527 17:16630005-16630027 ACTCTGCCATTGTAGCACCAAGG - Intronic
1149014573 17:51892807-51892829 ATGCAGTCATTTTAGCACAATGG + Intronic
1150365824 17:64583255-64583277 ATGCTGTCATTGTAGCTCCAGGG - Intronic
1150729416 17:67678940-67678962 ATGCTGACGTTGCAGGTCCAGGG - Intronic
1150863195 17:68822540-68822562 ATGCTGTAATTGTGCCTCCCAGG + Intergenic
1151030130 17:70727974-70727996 ATGCAGTCATTGGTTCTCCACGG - Intergenic
1153266459 18:3275149-3275171 ATCCTGTCATTGCAGCAACATGG + Intronic
1155154018 18:23143591-23143613 ATTCTGTCCTTGTAGCACAAAGG - Intronic
1156907042 18:42365662-42365684 ATGCTGTCTGTGTTTCTCCAAGG - Intergenic
1158162549 18:54501959-54501981 ATGCTGTTTCTATAGCTCCAGGG + Intergenic
1160162858 18:76488295-76488317 ATGCTGGAAGTGAAGCTCCAAGG + Intronic
1162036315 19:7941686-7941708 ATGCTGTGTCTGTACCTCCAGGG + Intronic
1162162431 19:8728496-8728518 CTGCTGTCATTGTGCCTCTATGG + Intergenic
1163084768 19:14971481-14971503 AGGCTGGCATTTTACCTCCAAGG + Intronic
925126456 2:1460875-1460897 ATTCTCTCAGTGCAGCTCCAGGG - Intronic
925738672 2:6986181-6986203 AGGCTGTCACTGTACCTTCATGG - Intronic
926692855 2:15749070-15749092 ATGCTGTCTTGGGAACTCCAAGG - Intergenic
928912056 2:36431885-36431907 TTGCTGTCATTGTTGCACAAAGG + Intronic
929003807 2:37375907-37375929 AGCCTGTTATTGTAGCTCGAGGG + Intergenic
932358052 2:71082867-71082889 ATTCTGTCATTATAGTTCCAGGG + Intergenic
933339385 2:81003597-81003619 CTGCTGATTTTGTAGCTCCAGGG - Intergenic
936584569 2:113743959-113743981 TTTCTGTCATTGTAGCTGTATGG - Intronic
936818015 2:116484384-116484406 AGGATGTCACTGTGGCTCCAGGG - Intergenic
936957557 2:118038221-118038243 TTGCAGTCATAGCAGCTCCAGGG - Intergenic
937109153 2:119349548-119349570 GAGCTGTCATTGTAGCTGGAGGG - Intronic
937697264 2:124821732-124821754 ATGCTGGTACTGTAGGTCCAGGG - Intronic
939537399 2:143448730-143448752 ATATTGTCATTGTTGGTCCATGG - Intronic
940587246 2:155669002-155669024 ATGCTTTCATTATACCTCCTAGG - Intergenic
941468179 2:165854844-165854866 ATGGTGTCAGTGGGGCTCCAGGG + Intergenic
944329814 2:198452337-198452359 TTGCTCTCATTGTTGCTTCATGG + Intronic
944632629 2:201642879-201642901 AAGCTGTGATTGCAGCGCCACGG - Intronic
947671805 2:231941750-231941772 ATCTTGTGATCGTAGCTCCATGG + Intergenic
1170128989 20:12998524-12998546 ATGGTTTTGTTGTAGCTCCAAGG - Intergenic
1174310125 20:49646477-49646499 ATACAGTAATTGTAGCTCAATGG - Intronic
1176983087 21:15405416-15405438 AAGCTCTCATGGCAGCTCCAAGG - Intergenic
1178016353 21:28350807-28350829 ATGCTGTCAGTATAGTTCCATGG + Intergenic
1179377467 21:40863455-40863477 ATGCTGACACTGCTGCTCCATGG + Intergenic
1180359514 22:11874694-11874716 TTGCTGTCATTGTCGCTACTGGG + Intergenic
1181481671 22:23203862-23203884 TGGCTTTCATTGAAGCTCCAAGG + Intronic
1181952543 22:26564832-26564854 ATGCTGACTTTGCAGGTCCAAGG - Intronic
949364394 3:3265014-3265036 CTGCTGTAATTGGCGCTCCAAGG + Intergenic
949592440 3:5508587-5508609 ATGCTGTTATGGTAGATTCAGGG + Intergenic
953468298 3:43144765-43144787 ATGCTGTGATTCTATCTGCAAGG + Intergenic
955260224 3:57381675-57381697 ATACAGACATTCTAGCTCCAGGG + Intronic
955305921 3:57831755-57831777 ATGCTGTCATTGCAGCTGACTGG - Intronic
956245958 3:67183447-67183469 ATGCTGTCATTGTAACATGAAGG + Intergenic
956763213 3:72461806-72461828 ATGGTGTCATTGAAGCCACAGGG + Intergenic
957051456 3:75415373-75415395 ATTCTGCTATTGTAGCTCAAAGG - Intergenic
959680105 3:109085926-109085948 ATCCTGTCACTGTAGCAACATGG + Intronic
961303023 3:125934221-125934243 ATTCTGCTATTGTAGCTCAAAGG + Intronic
961885048 3:130091564-130091586 ATTCTGCTATTGTAGCTCAAAGG - Intronic
969819696 4:9710484-9710506 ATTCTGCTATTGTAGCTCAAAGG + Intergenic
970336074 4:15044259-15044281 GTGCTATCATTGTAGTTTCAAGG - Intronic
976945384 4:90759554-90759576 ATGTTGTTATTGTTGCACCATGG + Intronic
980992711 4:139751798-139751820 AAGATGTCATTGTAACTCCATGG - Intronic
981595997 4:146422978-146423000 ATGCTTTCAATGTAGCTGCTGGG - Intronic
981624504 4:146740315-146740337 ATGCTTTTATTGTAGCTCAAGGG + Intronic
984376898 4:178943096-178943118 ATTCTGTCATATTATCTCCAGGG - Intergenic
984843610 4:184091406-184091428 AAGTTGTCATGGCAGCTCCAGGG + Intronic
1202769823 4_GL000008v2_random:193660-193682 TTGCTGTCATTGTCGCTACTGGG - Intergenic
988150859 5:27377841-27377863 ATGCTGTAATTCTAGCGCAAAGG + Intergenic
993260437 5:85651162-85651184 ACTCTGCCACTGTAGCTCCAAGG + Intergenic
993577198 5:89616727-89616749 AATCTGTCATTGTAGCACCGAGG + Intergenic
996991115 5:129633537-129633559 ATACTGCCATTGTAGCTTGAGGG - Intronic
999192081 5:149755945-149755967 ATGGTGTCATTGTTGCTGCTTGG + Intronic
1000049092 5:157546668-157546690 ATGCAGCCATTATAGCTCCTTGG + Intronic
1001371935 5:171213063-171213085 TTGGTCTCACTGTAGCTCCAAGG - Intronic
1002800259 6:515527-515549 ATGCAGCCAGTGTGGCTCCAGGG + Intronic
1004315451 6:14582957-14582979 ATGGTTTCCTTGAAGCTCCAGGG + Intergenic
1004977691 6:20985965-20985987 ATTCTCTCATCATAGCTCCAGGG + Intronic
1005460805 6:26067894-26067916 ATGCAGTCTTTGTAGGTCCTTGG - Intergenic
1007640140 6:43331634-43331656 ATCCTGTCATTTTAGCTGCCAGG - Intronic
1007910208 6:45505833-45505855 ATTCTGACATTGGTGCTCCATGG + Intronic
1008540908 6:52545819-52545841 ATGCTGACATTCCAACTCCAAGG + Intronic
1013259949 6:108431916-108431938 ATGGTGTCTTTGAAGCACCATGG + Intronic
1014001192 6:116368620-116368642 TTGCTGCCATGGAAGCTCCAAGG + Intronic
1016733952 6:147455731-147455753 ATCCAGCCAGTGTAGCTCCAAGG - Intergenic
1017798382 6:157869007-157869029 TTCCTGTCTTTGTATCTCCAGGG - Intronic
1020318519 7:6924118-6924140 ATTCTGCTATTGTAGCTCAAAGG - Intergenic
1036381900 8:8241075-8241097 ATTCTGCTATTGTAGCTCAAAGG + Intergenic
1037343695 8:17875055-17875077 CTGCTTTCATTTTAGCTTCATGG - Intronic
1040666923 8:49644882-49644904 ATGTTGACATTGCATCTCCAAGG + Intergenic
1042165075 8:65937110-65937132 AGGCTGTAATTGAAGTTCCAAGG + Intergenic
1042391711 8:68243460-68243482 ATGCTGTCAGTGGATCTCCTGGG + Intergenic
1042744392 8:72091395-72091417 TTGCAGTTATTGTAGCTACATGG - Intronic
1048716364 8:137274985-137275007 AGGCTGACATTGAAGCTCCAGGG + Intergenic
1048775703 8:137943778-137943800 ATGCCATCTTTCTAGCTCCATGG + Intergenic
1050849521 9:10265602-10265624 ACTCTGTCATTGTAGCACAAAGG + Intronic
1051250645 9:15155201-15155223 ATTCTGACATTTTAGCGCCATGG - Intergenic
1052604716 9:30684430-30684452 ATGTTATCATTGTAGCTGCCAGG - Intergenic
1053009304 9:34624281-34624303 ACGCTGTCATTGTAGCCTAAAGG + Intronic
1054884171 9:70178000-70178022 ATGTTGTCAGTGTAACCCCAGGG + Intronic
1057360069 9:94365222-94365244 TTGTTGTCATTGTAGAGCCAAGG - Intergenic
1057663272 9:97022867-97022889 TTGTTGTCATTGTAGAGCCAAGG + Intergenic
1058729649 9:107837422-107837444 ATGTTTTCATTGTTTCTCCATGG - Intergenic
1059800097 9:117741529-117741551 ATGCTGACAGTTTAGCCCCACGG + Intergenic
1060751693 9:126173904-126173926 AAGCAGTCATTTTAGCTGCATGG - Intergenic
1187178749 X:16922168-16922190 ATCCTGTCATTGCAGCAACATGG + Intergenic
1187235949 X:17467326-17467348 ATGCTGTGTTTGTAGCTGAAAGG - Intronic
1187305639 X:18093214-18093236 AGGATGACATTGTGGCTCCAGGG + Intergenic
1189387229 X:40547070-40547092 ATGATGTCATTGTTGCTTTAGGG - Intergenic
1190450969 X:50580343-50580365 ATGCTGCCATTGTTGCTTCAAGG + Intergenic
1191054320 X:56226850-56226872 ATCCTGTTATTGTGGCTCCAGGG + Intergenic
1193200229 X:78681087-78681109 AAGCTGTCACTGGAGCTCAAGGG + Intergenic
1198449599 X:136754025-136754047 CTTCTGTCATAGGAGCTCCATGG - Intronic
1198692053 X:139295120-139295142 TTGCTGTCATTTCAGCACCAAGG + Intergenic
1201453484 Y:14142351-14142373 ATGCTTTCATGGGAGATCCAAGG - Intergenic