ID: 1150368305

View in Genome Browser
Species Human (GRCh38)
Location 17:64611609-64611631
Sequence AGAGAGAAGTAGACAGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 906
Summary {0: 1, 1: 0, 2: 4, 3: 86, 4: 815}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150368305_1150368309 19 Left 1150368305 17:64611609-64611631 CCTTCATCTGTCTACTTCTCTCT 0: 1
1: 0
2: 4
3: 86
4: 815
Right 1150368309 17:64611651-64611673 TAGTCCACCATCTACTGTCTAGG 0: 1
1: 0
2: 1
3: 3
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150368305 Original CRISPR AGAGAGAAGTAGACAGATGA AGG (reversed) Intronic
900818607 1:4869463-4869485 AGAGGGAAGTGGACACATTAAGG + Intergenic
900864215 1:5255752-5255774 AGAGAGAAGTGATCAGAAGAGGG + Intergenic
901139844 1:7021380-7021402 AGAGAGAAGCTGAGCGATGAGGG - Intronic
901755980 1:11441857-11441879 AGAGAGGAGGAGGAAGATGAGGG + Intergenic
901783934 1:11612184-11612206 AGAGAGAAGAAGACAGGGGAAGG + Intergenic
901896117 1:12313734-12313756 AGCTAGAAGCTGACAGATGAAGG + Intronic
903295821 1:22342574-22342596 AGAGATAAGGAGACAGAGAAAGG + Intergenic
903658931 1:24965325-24965347 AGAGAGAAATAGAAAAGTGATGG + Intergenic
905251759 1:36653470-36653492 ACAGTGCAGGAGACAGATGACGG + Intergenic
905921022 1:41718730-41718752 AGAGAGACAGAGACAGAGGAGGG - Intronic
906174743 1:43761505-43761527 AGAGAGAAGGAGAAAGAAAAGGG + Intronic
906294094 1:44638385-44638407 AGAGAGAAGGAGGCAGAGGCAGG + Intronic
906529129 1:46513084-46513106 AGAGACAAGGAGAAAGATCAAGG - Exonic
907175694 1:52520182-52520204 GGTGAGAAGTAAACAAATGAGGG + Intronic
907290043 1:53407763-53407785 AGAGAGAAGGAAACAGAGAAGGG - Intergenic
908160645 1:61404652-61404674 AGAGAAAGGTAGGGAGATGAAGG + Intronic
908814610 1:68018919-68018941 AGAGAAAAATAGACAAATGATGG + Intergenic
909237178 1:73167565-73167587 AGAGAAAAGTATACAGAAGGAGG + Intergenic
909267853 1:73584596-73584618 AAAGAAAATTAGAGAGATGATGG + Intergenic
909332618 1:74432431-74432453 AGAGAGAAATAGAAGGGTGACGG - Intronic
909777230 1:79496828-79496850 AGAAAAAAGTTGAAAGATGAAGG - Intergenic
910212435 1:84807165-84807187 ACAGAGAAGGAAACAAATGAAGG - Intergenic
910711379 1:90185864-90185886 CGAGAGCAGAGGACAGATGAAGG + Intergenic
910801364 1:91150003-91150025 AGACAGAGAGAGACAGATGAAGG + Intergenic
911026133 1:93436874-93436896 AGATAAAAGGAGCCAGATGATGG + Intergenic
911288237 1:96024278-96024300 AGAGATCATTAGACAGAGGATGG - Intergenic
911664064 1:100534424-100534446 ACAGAGATGGAGAAAGATGAAGG - Intergenic
911845320 1:102745436-102745458 AGAGAGAAAGAGACAGACAAAGG - Intergenic
912186135 1:107278074-107278096 AGAGAGAAGTAGTGAGCTCATGG - Intronic
912207445 1:107524094-107524116 AGAGAAAAGAAGACAGAAGGGGG - Intergenic
912280917 1:108312472-108312494 AGAGAAAAGTAGGAAGAGGATGG + Intergenic
913074383 1:115329075-115329097 AGAAGGAAGTAGAAAGAGGAAGG + Intronic
913234789 1:116770426-116770448 AGAGAGAGAGAGAGAGATGAGGG + Intergenic
914941693 1:152028849-152028871 AGAGAGAAAGAGAGAGATGAGGG + Intergenic
915906367 1:159880770-159880792 AGAGAGATGCAGACAGAGGAGGG + Intronic
916175879 1:162037968-162037990 AGAGAGAAGTAGAACTAAGATGG + Intergenic
916374380 1:164136260-164136282 AGGGAGAAATAGGGAGATGATGG + Intergenic
918209090 1:182335021-182335043 AGAGAGAAAGAGACAGAGGAAGG + Intergenic
918931609 1:190862161-190862183 AGAGAGTGTTAGACAGATCATGG - Intergenic
919113304 1:193247377-193247399 AGAGAGAGAGAGAGAGATGAGGG - Intronic
919127126 1:193408633-193408655 ATAGAGAGATAGACAGATGATGG - Intergenic
919210217 1:194473160-194473182 AGAGAGAAGTGAACATATAAAGG + Intergenic
920181952 1:204137481-204137503 AGAGAGAGGTAGACTGGTTAAGG + Intronic
920573496 1:207036528-207036550 AAAGAGAGGTAGACAGTTTATGG - Intronic
920742375 1:208593543-208593565 AGAGAGAATTTGACATTTGAGGG + Intergenic
920799203 1:209172117-209172139 AGAGAGAAGGAGGGAGATGGGGG - Intergenic
921620127 1:217315966-217315988 AGAGATAGGTAGATAGATGAAGG - Intergenic
922493261 1:226035849-226035871 AGAGGGAAGTAAAAAGGTGAAGG - Intergenic
922720870 1:227899709-227899731 AGAGAGACGGAGAAAGATGGAGG - Intergenic
922740477 1:228011431-228011453 AGAGAGACACAGACAGATGCGGG - Intronic
922892051 1:229069365-229069387 ATAGATACATAGACAGATGATGG + Intergenic
922914985 1:229249907-229249929 AGAGAGAAAGAGAGAGAGGAAGG - Exonic
923375275 1:233355873-233355895 AAGGAGAAGGGGACAGATGAGGG - Intronic
923379723 1:233404090-233404112 AGAGAGAGGTAGAGAGACGGGGG - Intergenic
924113071 1:240719245-240719267 AGAGAGAACTAGAAAGTAGAAGG + Intergenic
924927105 1:248693692-248693714 AGAGTGGAGAAGACAGAGGATGG - Intergenic
1062930230 10:1348028-1348050 AGAGAGACAGAGACAGAAGAGGG + Intronic
1062948125 10:1476198-1476220 AGAGAGAAAGGGAGAGATGAGGG + Intronic
1063155522 10:3375814-3375836 AGAGAGAAGGAGAGAGAGGGAGG - Intergenic
1063163362 10:3437205-3437227 AGAGAGAAATAGAGAGATGGGGG - Intergenic
1063255830 10:4326347-4326369 AGAGAGAGAGAGACAGATGCGGG - Intergenic
1063485757 10:6419162-6419184 AGACAGAAGTAGATAGTTAATGG - Intergenic
1064306770 10:14174321-14174343 AGAGAGCTGTAGGCAGATTATGG - Intronic
1064464945 10:15569548-15569570 AGTAAGAAGCAGACAGAGGATGG - Intronic
1064674264 10:17745768-17745790 AGACAGAAGTAGGCAGCAGAAGG - Intergenic
1064819121 10:19304332-19304354 AGAGAGAGAGAGAGAGATGAGGG - Intronic
1065043099 10:21717542-21717564 AGAAAGAAGAAGAAAGAAGAAGG - Intronic
1065225011 10:23534616-23534638 ACTCAGAAGTAAACAGATGATGG - Intergenic
1065258481 10:23899939-23899961 AGAGAGAAAGAGAGAGAGGAAGG - Intronic
1065497231 10:26341872-26341894 AGAGAGAAAGAGAGAGAGGAAGG + Intergenic
1065497261 10:26342007-26342029 AGAGAGAAAGAGAGAGAGGAAGG + Intergenic
1065507233 10:26441374-26441396 AGAGAGAACTAGCCGCATGAAGG + Intronic
1066044242 10:31582257-31582279 TGAGGGAGGCAGACAGATGAGGG - Intergenic
1066147313 10:32574950-32574972 AAAGAGAACTGGACATATGAAGG - Intronic
1066192588 10:33069520-33069542 AGAGAGAAGGAGAGAGAGGAAGG - Intergenic
1066359186 10:34714025-34714047 AGGGAGAAGTAAACAGGAGAGGG - Intronic
1066588448 10:36964531-36964553 AGAGAGAAGTATAGAAAGGAAGG + Intergenic
1067304861 10:45053521-45053543 AGACAGAAATGGAGAGATGATGG - Intergenic
1067381409 10:45777035-45777057 AGACACAAGTAGACAGATACAGG + Intronic
1067889110 10:50117668-50117690 AGACACAAGTAGACAGATACAGG + Intronic
1068148724 10:53104779-53104801 AGAGAGAAAGAGACAGAGGAGGG + Intergenic
1068218543 10:54013328-54013350 GGACAGTAATAGACAGATGATGG + Intronic
1068222578 10:54063343-54063365 AGAGAGAAGTTGAGAGAAGTTGG - Intronic
1069013041 10:63395913-63395935 TGAGAAAAAAAGACAGATGAAGG + Intronic
1069519904 10:69110641-69110663 AGAGAGAAGTAGCCTGAGGTTGG + Intergenic
1069785552 10:70985814-70985836 AGAGAGAAGCAGACACAAGGTGG - Intergenic
1070318757 10:75338623-75338645 AGAGAGGAGGAGAGGGATGAGGG - Intergenic
1070418883 10:76216493-76216515 ATAGAGAAGTAGGCACAAGATGG + Intronic
1070978479 10:80624969-80624991 GGAGAGAAGCACACAGGTGAGGG - Intronic
1071587681 10:86841104-86841126 TGAAAGAAATGGACAGATGAAGG - Intronic
1071779502 10:88827196-88827218 AGAGAAAAGTAGGCAGAGAAAGG - Intronic
1073028797 10:100508350-100508372 GGAGAGAAGGAGGAAGATGAGGG + Intronic
1073955434 10:108865838-108865860 AGAGAACTGTATACAGATGATGG + Intergenic
1074817365 10:117152528-117152550 AGAGCAAAGAAGAAAGATGAAGG + Intergenic
1074866766 10:117548505-117548527 AGAGAGAAGGAGAAAGAGGGAGG + Exonic
1074967464 10:118504041-118504063 AAAGAAAAGTAAACAGAGGAAGG + Intergenic
1075556547 10:123436421-123436443 AAAGACAAGTAGAAAGAGGAGGG - Intergenic
1075570120 10:123535631-123535653 AGAGAGAAGTAGAGAGGAGGGGG + Intergenic
1075643452 10:124081997-124082019 AGAAAGAACTAGAAAGATGCTGG + Intronic
1075889574 10:125935065-125935087 AGAAACAAGCAGAGAGATGAAGG - Intronic
1075906395 10:126085521-126085543 AGATAGAAATGGACAGATAATGG - Intronic
1076204331 10:128583747-128583769 GAAGATAAGTAGATAGATGATGG - Intergenic
1076241341 10:128910400-128910422 TGGGAGAAGTAGACAGGGGATGG - Intergenic
1076596089 10:131624346-131624368 AGAGAGATGGAGAGAGATGGGGG + Intergenic
1077729755 11:4717555-4717577 AGAGACAAGTAGATACATGATGG + Intronic
1078096789 11:8302446-8302468 AGAGAGAAGAAGAAAGGAGAAGG + Intergenic
1078978508 11:16505123-16505145 AGAGGAAGGTAGAAAGATGAGGG + Intronic
1079030841 11:16985439-16985461 AGAGAGATGTAGACACAAAAAGG + Intronic
1079130764 11:17745645-17745667 AGAGAGAAGCAGACAGCAGAGGG - Intronic
1079704920 11:23602903-23602925 AGAAAGAAATATATAGATGAAGG - Intergenic
1079729876 11:23926723-23926745 ATAGAGAAGTACACAGTTAAGGG + Intergenic
1079905089 11:26235009-26235031 AGAGAGAGAGAGAGAGATGAGGG + Intergenic
1080032231 11:27673911-27673933 AGAGAGATGAAAACAGGTGATGG + Intronic
1080614453 11:33933948-33933970 AAAGAGAAGAGAACAGATGAGGG - Intergenic
1080673724 11:34405471-34405493 AGAGAGAAGTGGAGAGATGGGGG - Intergenic
1080729850 11:34938209-34938231 AAAGAGAAGTTGACATATGAAGG + Intronic
1080976779 11:37351852-37351874 AGTGGGAAGTAGACAGTTGAGGG + Intergenic
1081155497 11:39684473-39684495 AGAGAGAGATAGAGAGAGGAAGG - Intergenic
1081346079 11:41988099-41988121 AGAGAGATGGAAACAGAAGAGGG + Intergenic
1081699558 11:45144577-45144599 AAAGAGAAGTAGATAAAGGAGGG - Intronic
1081956860 11:47100398-47100420 AGACAGATGTAGGCTGATGATGG - Intronic
1082098486 11:48151339-48151361 AAAGAGACATAGACACATGAGGG - Intronic
1082750089 11:57005944-57005966 AGAGAGAGCTTGGCAGATGATGG - Intergenic
1083040132 11:59677872-59677894 AAAGAGAGGGAGAAAGATGAGGG + Intergenic
1084513170 11:69618640-69618662 AGAGAGAAGGAGACAGTTTTGGG - Intergenic
1084886000 11:72207291-72207313 AGAGAGAAAGAGAGAGAGGAAGG + Intergenic
1084936198 11:72588034-72588056 GGGGAGAAGTAGACAGATGAGGG - Intronic
1085214650 11:74818192-74818214 AGAGGGAATTGGATAGATGATGG + Intronic
1085558190 11:77444877-77444899 AGAGAGAAGTAGAGATATTGTGG - Intronic
1085855837 11:80174698-80174720 AGAGAGAGGCAGAAAGAGGAAGG + Intergenic
1086165793 11:83776272-83776294 AGAGAGAAGTAGATAGATTCAGG - Intronic
1086304129 11:85461317-85461339 AGAGAAAAGAATACAGTTGAGGG + Intronic
1086482814 11:87261568-87261590 AGAGAGAAGTACAAAGAGGGAGG - Intronic
1086660206 11:89406914-89406936 ACAGAGAAGAAGGCAGCTGAAGG + Intronic
1087363172 11:97186206-97186228 AGACAGGAGTAAACAGATAAGGG + Intergenic
1087378983 11:97380637-97380659 AGAAAGAAGTGGACAATTGAAGG - Intergenic
1087496498 11:98896946-98896968 GGAGAGGAGGAGACAGAGGAGGG + Intergenic
1087825353 11:102758599-102758621 AGAGAGAGGTAGTAGGATGAAGG - Intergenic
1087862410 11:103176505-103176527 AAAGATAAGTTGAAAGATGAAGG - Intronic
1087973613 11:104516656-104516678 GAAGAGAAGGAGAAAGATGAGGG - Intergenic
1088587468 11:111372074-111372096 AGAGAGAGAGAGAGAGATGAAGG + Intronic
1088691895 11:112335514-112335536 AGAGAGAAGCAGACAGGAGTGGG - Intergenic
1088950357 11:114563275-114563297 AGAGATAAAAAGAGAGATGAGGG - Intergenic
1089134775 11:116240358-116240380 AGAGAGAAAGAGAGAGAGGAAGG + Intergenic
1089145617 11:116327834-116327856 AGAGAGAGAGAGACAGAGGAGGG - Intergenic
1089502201 11:118939360-118939382 AGAGAGATGTGGACAGAGGCAGG + Intronic
1089819823 11:121214298-121214320 TGAGAGCATTAGACAGATCAAGG + Intergenic
1090125245 11:124077410-124077432 AGAGAGAAAAAGAAAGAAGATGG - Intergenic
1090339086 11:125999658-125999680 AATGAGAAGGAGAAAGATGATGG - Intronic
1090554201 11:127856093-127856115 AAAGAGAAGTAAACAGTTGGAGG - Intergenic
1090833433 11:130436463-130436485 AGAGAGACGTAGACAGTAGAGGG + Intergenic
1090915959 11:131162170-131162192 AGAGAGAAGAAGGGAGCTGATGG - Intergenic
1091037697 11:132248312-132248334 AGAGAGAGGAAGACAGAGCAAGG - Intronic
1091967634 12:4758661-4758683 AGAGAGAGAGAGAGAGATGATGG + Intronic
1092139794 12:6175676-6175698 ATAAAGAAGTAGAGAAATGAGGG + Intergenic
1092498898 12:9026182-9026204 AAAGAGAAGTAGCCAGAAGTAGG + Intergenic
1092622056 12:10283044-10283066 AGAGGGAAGTTAACAGAGGAGGG + Intergenic
1093009748 12:14094013-14094035 AGAAAGAAAGAGAGAGATGAAGG + Intergenic
1093056344 12:14559761-14559783 AGAGAGAAATATAAAAATGATGG - Intronic
1093191224 12:16077471-16077493 ACAGAGAAGTAAACAGACAAAGG + Intergenic
1093410166 12:18855769-18855791 AGAGAGAAGGACAAAGATGGAGG + Intergenic
1093704351 12:22258060-22258082 AGTGAGAAGTAGCCAGAAGCTGG + Intronic
1093913347 12:24772326-24772348 ACAGGGAAGCAAACAGATGATGG + Intergenic
1094348841 12:29500388-29500410 AGGAAGAAGTAAAAAGATGAAGG + Intergenic
1094467211 12:30766192-30766214 AGAGAGAAGTGGACAGAATTGGG - Intergenic
1095051245 12:37556116-37556138 AGAGAGAAAGAGACAGAGAAAGG + Intergenic
1095154971 12:38841857-38841879 AGGGAGAAGCAGAAAGATGAAGG + Intronic
1095598442 12:43986767-43986789 ACAGAGAAATAGAAAGGTGAAGG - Intronic
1095714151 12:45323416-45323438 AGAGAGAAGAAGCAAGATGCAGG + Intronic
1095876134 12:47080786-47080808 AGAGAGAGGGAGAGAGAAGAGGG - Intronic
1096064884 12:48731732-48731754 AGAGAGAGGGAGAGAGATGAGGG - Intergenic
1096830877 12:54313142-54313164 AGAGAGAAAGAGAGAGAGGAAGG + Intronic
1096938435 12:55310872-55310894 GGAGAGAACAAGACAGATAAAGG + Intergenic
1097721267 12:63024074-63024096 AGAGAGAGCAAGACAGATGGGGG - Intergenic
1097866435 12:64563002-64563024 AGAGAGAAGTAGACGGACATTGG - Intergenic
1098484515 12:71005233-71005255 AGGGAGATGTAGTCAGAGGATGG - Intergenic
1098713566 12:73800420-73800442 AGAGAGAAGGAGATGAATGAGGG - Intergenic
1099604421 12:84784127-84784149 AGAGAGAAGGAGAGAGAAGAAGG + Intergenic
1099980094 12:89589348-89589370 AAAGAGAAGAAGGTAGATGAAGG + Exonic
1100141475 12:91623974-91623996 AGAGAAAGGTAGACAGATTTGGG - Intergenic
1100162404 12:91875429-91875451 AGAGAGAGATAGATAGATAAAGG - Intergenic
1100285932 12:93166391-93166413 AGAGAGATGAAGGAAGATGAAGG + Intergenic
1100698584 12:97121997-97122019 ACAGAGAAGTATAAAGAAGAAGG + Intergenic
1100699274 12:97129040-97129062 AGAGAGAAGTAGAAATGTGTGGG - Intergenic
1100913838 12:99395082-99395104 AGAGAGAAATGGAGAGATGTTGG - Intronic
1100997483 12:100318250-100318272 AGAAAGAAGCAGAAAGATGAAGG - Intronic
1101010322 12:100443050-100443072 AGAGAGAAAGAGACAAAGGAAGG - Intergenic
1101077077 12:101141590-101141612 TCTGAGAAGTAGACAGAGGATGG + Intergenic
1102009259 12:109607950-109607972 ACAGAGAAGTAGACAGACAAAGG + Intergenic
1102661915 12:114536562-114536584 AGAAAGAAAGAGACAGAGGAAGG + Intergenic
1102665769 12:114571461-114571483 AGAAAGAAAGAGACAGAGGAAGG - Intergenic
1104269802 12:127272958-127272980 AGAGAGAAGTGGATTGATCATGG - Intergenic
1104486027 12:129151751-129151773 GAAGAGAAGCAGACAGAAGACGG - Intronic
1104586518 12:130052435-130052457 AGAGAGAATTGATCAGATGACGG + Intergenic
1105927960 13:25024823-25024845 GGAGAGAAGTTAACAGATGCTGG + Intergenic
1106243837 13:27930029-27930051 AGAGAGAATGAGACAGAGAATGG - Intergenic
1106357874 13:29001363-29001385 TGGGAGAAGTAGTCAGATGCTGG + Intronic
1106547926 13:30746335-30746357 AGAGGGAAGGAGAAGGATGAGGG + Intronic
1107403462 13:40091665-40091687 AGAGGGAGGTAGCCAGAGGAAGG - Intergenic
1107733571 13:43372858-43372880 AGACAGCAGCAGACAGATGGAGG + Intronic
1107955175 13:45504620-45504642 GGAGAGAAATACAGAGATGAGGG + Intronic
1107998738 13:45887578-45887600 AGAGAGAAATAAAATGATGATGG + Intergenic
1108021205 13:46129430-46129452 AGAAGGAAGTAGACAGGTGAAGG - Intronic
1108133056 13:47324028-47324050 AGAGACAAGTAGAAAGCAGAAGG + Intergenic
1108164858 13:47681835-47681857 ATGGTGAAGTAGACAGAGGAGGG + Intergenic
1108392090 13:49956508-49956530 AGAAAGAAGAAGAAAGAGGAAGG - Intergenic
1108935391 13:55875383-55875405 AGGAAGAATTAGACAGAAGAGGG - Intergenic
1109210465 13:59529514-59529536 TGAGTGAAGTAGTCAGAAGAAGG + Intergenic
1109651530 13:65333618-65333640 AGAGTGAAGTAAACAGATTTGGG + Intergenic
1109653958 13:65365959-65365981 GGAGATAAGCAGACAGATGGTGG + Intergenic
1109747418 13:66644954-66644976 AGATGGAAGAAGATAGATGATGG + Intronic
1109903791 13:68810582-68810604 AGAGATAAGTGGGCAGGTGAGGG - Intergenic
1110512815 13:76372500-76372522 AGAGAGAGAGAGAGAGATGAGGG - Intergenic
1110555200 13:76851931-76851953 AGAGAGATTGAGTCAGATGATGG + Intergenic
1111469483 13:88659672-88659694 AGAGAGAGGAAGACAGAGGAGGG + Intergenic
1111499787 13:89103123-89103145 AGAGAGAAAAGGACAGTTGACGG + Intergenic
1111514734 13:89314183-89314205 AGAGAGAAAGAGAGAGAGGAAGG + Intergenic
1111536536 13:89608756-89608778 GCAGAGCAGTAGACAAATGAAGG + Intergenic
1112475209 13:99725527-99725549 AGAGGGCAGCAGAGAGATGAAGG + Intronic
1113340373 13:109417142-109417164 ATAGATAATTAGACAGAGGATGG - Intergenic
1113939967 13:114013615-114013637 AGAGAGAGAGAGACAGATGGAGG - Intronic
1114013846 14:18405703-18405725 AGAGACAAATAAACAGATGATGG + Intergenic
1114152456 14:20059089-20059111 GAAGAGAAGGAGAGAGATGAGGG + Intergenic
1114269779 14:21093515-21093537 AGAGAGAGGTAGGCAGGAGAGGG + Intronic
1114423815 14:22605797-22605819 AGAGAGAAAGAGAGAGATCAGGG + Intronic
1114522671 14:23348729-23348751 AGAGAGAAGAAGAAAGAGGGAGG + Intronic
1115132202 14:30067368-30067390 AGAGAGCAGTACTCAGATCATGG - Intronic
1115158797 14:30369586-30369608 AGAGAGAACTCCATAGATGAGGG + Intergenic
1115952104 14:38732957-38732979 AGAAAGAAGTAGGCAAATTATGG - Intergenic
1116510377 14:45737920-45737942 AGAGAGCAACAGACAGATGGAGG + Intergenic
1116609906 14:47055228-47055250 AGAGACAATTAGAGAAATGATGG - Intronic
1116629282 14:47308795-47308817 AGACTGTAGTAGACAGAGGAGGG - Intronic
1116964452 14:50999858-50999880 TGAGAGAAGCAGACACATGCCGG + Intronic
1117788566 14:59313898-59313920 AGATTGAAGAAGCCAGATGATGG - Intronic
1118604562 14:67493297-67493319 AAAGACAAGTACACAGGTGATGG - Intronic
1118656387 14:67954499-67954521 CCAGAGGAGAAGACAGATGAAGG + Intronic
1118689612 14:68325609-68325631 AGAAAGCAGTAGACAGAAAAAGG - Intronic
1118689819 14:68327418-68327440 AGAAAGCAGTAGACAGAAAAAGG - Intronic
1119987701 14:79157787-79157809 AGAGAGAAGTGAAAATATGAAGG + Intronic
1120008862 14:79390412-79390434 AGAAAGAGGTAGGCAGAGGATGG - Intronic
1121367234 14:93324879-93324901 AGAGAAAAGTAGACATTAGATGG + Intronic
1121550097 14:94792834-94792856 AGAGAGAAAGAGAAAGAGGAAGG + Intergenic
1121961827 14:98267250-98267272 AGAGAGAGAGAGACAGATAATGG + Intergenic
1122861747 14:104585633-104585655 AGAGAGAATCAGAGAGAGGAAGG + Intronic
1123161711 14:106285067-106285089 AGAGAGAGAGAGAGAGATGAGGG - Intergenic
1124153108 15:27199976-27199998 AGAGAGGAGTAGAGGGAGGAAGG - Intronic
1124459636 15:29877623-29877645 AAAGAGAAGAAGAAAGAAGAAGG - Intronic
1124532463 15:30519542-30519564 AAAGAGAGAGAGACAGATGAAGG - Intergenic
1124766190 15:32488103-32488125 AAAGAGAGAGAGACAGATGAAGG + Intergenic
1125000557 15:34765654-34765676 AAAGAGAAGGAGAGAGATGAGGG + Intergenic
1125718659 15:41834712-41834734 AGAAAGAAGAAGACAGGGGATGG - Intronic
1126483191 15:49150445-49150467 AAAGATCAGTAGAAAGATGATGG - Intronic
1126686966 15:51256892-51256914 AAAGAGGTGTAGTCAGATGATGG + Intronic
1126860429 15:52877583-52877605 AGAGAGAAATAGAGAGATGGAGG - Intergenic
1127001358 15:54510786-54510808 AAAGAGAAATAGACAAAGGAAGG - Intronic
1127502845 15:59570753-59570775 AGAAAGAAGAAAAAAGATGAGGG - Intergenic
1127556019 15:60088516-60088538 AGGGAGAACGAGAGAGATGAAGG + Intergenic
1127689750 15:61383902-61383924 AGAGATAATTAGACAAATCAAGG - Intergenic
1128237906 15:66080044-66080066 AAAGAGAAGGAGACAGAGGCTGG + Intronic
1128524265 15:68401896-68401918 CGAGAGAATTAGCCAGATGGTGG + Intronic
1128532665 15:68465210-68465232 AGAAAGAAGTAGGCACCTGAAGG - Intergenic
1128759328 15:70204796-70204818 AGAGAGAGATAGACAGATGGGGG + Intergenic
1129107992 15:73322443-73322465 AGAGAAAAGAAGAAAGAAGAGGG + Exonic
1129192758 15:73947033-73947055 GGAGAGAAGGAGAAAGAAGAGGG - Intronic
1130056240 15:80528429-80528451 ACAGATAGGTAGATAGATGATGG - Intronic
1130409852 15:83637242-83637264 AGGGAGAACTAGAGAGGTGATGG - Intergenic
1130863095 15:87908599-87908621 AGAGAGAAGAAAAGGGATGAAGG + Intronic
1130932368 15:88438659-88438681 AGAGAGAACTGGAAACATGATGG - Intergenic
1130961569 15:88662935-88662957 AGAGAAAAGAAGACAGATGGAGG + Intergenic
1131039149 15:89245959-89245981 GGAGAAAAGTAGACAGATTTGGG + Intronic
1131727168 15:95239359-95239381 AGAGAAAAGGAGAAAGAGGAAGG + Intergenic
1132281212 15:100617489-100617511 AGAGAGAAGCAGGCAGAGCAAGG - Intronic
1133517599 16:6524813-6524835 ACAGAGAAGGAGCCAGGTGATGG - Intronic
1133565188 16:6986678-6986700 AGAGAGAAGGAGAGAGAGAAGGG - Intronic
1134747366 16:16598694-16598716 AGAGAGAAGAAGAGAAATAATGG + Intergenic
1134998105 16:18754964-18754986 AGAGAGAAGAAGAGAAATAATGG - Intergenic
1135066558 16:19314969-19314991 AGAGGGAAGAAGAGAGAGGAAGG + Intronic
1135495832 16:22950383-22950405 AGAGACAAGTAGTCAGAGCAAGG + Intergenic
1135595319 16:23737714-23737736 AGAGGGAAGGAGAGAGAAGAAGG - Intergenic
1135663031 16:24313008-24313030 AGAGAGAAAGAGAGAGAGGAAGG + Intronic
1135784151 16:25333154-25333176 ATGGGGAAGGAGACAGATGAAGG + Intergenic
1136464966 16:30436424-30436446 AGAGAGAAAGAGAGAGAGGAAGG - Intergenic
1137781459 16:51101103-51101125 AGAGAGAAGGAGACAGAAAGTGG + Intergenic
1138103595 16:54274464-54274486 AGAGAGAATAAGAGAGAGGAAGG - Intergenic
1138211540 16:55167235-55167257 TGGGAGAAGTAGACAGATCATGG + Intergenic
1138784301 16:59828478-59828500 AGAGAGATGGAGACAGAGAAGGG + Intergenic
1139120639 16:64012172-64012194 AGAGAGAAGGACACAGATGGAGG - Intergenic
1139524083 16:67502771-67502793 AGAGAGAAAAAGAGAGATGGAGG + Intergenic
1139677614 16:68535735-68535757 AGAGAGTAGTAGGCAGAACATGG - Intronic
1140310608 16:73844779-73844801 AGAGATTAGTAGACAGATGATGG + Intergenic
1140565040 16:76031907-76031929 AGAGAGAACCAAAGAGATGATGG + Intergenic
1140857361 16:78989861-78989883 AGAGAGAGAGAGACAGATGGAGG + Intronic
1141113718 16:81290952-81290974 AAAGAGAAAGAGACAGAGGAAGG - Exonic
1141373643 16:83509635-83509657 AGAGAGAAGAAAACATATAAAGG + Intronic
1141752620 16:85969131-85969153 AGAGAGAAAGAGAGAGAGGAGGG + Intergenic
1142328842 16:89437342-89437364 AGAGTGAAGAAAACAGATGTTGG - Intronic
1142961950 17:3556880-3556902 AGCGTGAAGGAGACAGAAGAAGG + Intronic
1143369741 17:6431597-6431619 ATAGAGTAGCAGACAGAAGACGG + Intronic
1143384355 17:6518740-6518762 AGAGAGAAAGAGAAAGATGGAGG + Intronic
1144343359 17:14329408-14329430 AGAGAGAAAGAGAGAGAGGAAGG + Intronic
1144414213 17:15031148-15031170 AGAGAGAGGAAGGCAGATAATGG - Intergenic
1144588907 17:16507092-16507114 AGAGTTCTGTAGACAGATGATGG + Intergenic
1144602836 17:16633684-16633706 AGAGAGAGGGAGAGAGAAGATGG + Intronic
1145363067 17:22228186-22228208 ACAGATAAGTAAACAGATGCTGG + Intergenic
1145371880 17:22313053-22313075 AGAGAGAAAGAGACAGAGAAAGG + Intergenic
1146428681 17:32768971-32768993 AGAGAGGAGTAAACAAATCAGGG - Intronic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1146687608 17:34852039-34852061 AGAGAGAAGCCCACAGATGTGGG + Intergenic
1146915170 17:36673724-36673746 GAAGAGAAGAAGACAGAGGAGGG + Intergenic
1146936369 17:36814869-36814891 AGAGAGAATGAGAAAGAGGAAGG - Intergenic
1146954531 17:36929654-36929676 GGAGAGAAGTGGAGAGATGAAGG - Intergenic
1147381746 17:40060375-40060397 AGAGAGAGGTAAAAAGAAGATGG + Intronic
1148389771 17:47263057-47263079 AGAGAGCACCAGAGAGATGAAGG + Intronic
1148949558 17:51298608-51298630 AGAGAGAAGTCGGCGGAGGAGGG + Intergenic
1149115889 17:53096415-53096437 AGAAAGAAGAAGAAAGATGAAGG + Intergenic
1149512941 17:57257437-57257459 AGAGAGAAAGAGAGAGATGGGGG - Intronic
1150162921 17:62914498-62914520 GGAGAGAAGCAGACAGATTTGGG - Intergenic
1150368305 17:64611609-64611631 AGAGAGAAGTAGACAGATGAAGG - Intronic
1150510898 17:65752062-65752084 ATAGACATATAGACAGATGATGG - Intronic
1151350438 17:73528670-73528692 AGAGAGCAGGAGAGAGATGGAGG - Intronic
1151457661 17:74236041-74236063 AGACAGAAATAGAAAGTTGACGG - Intronic
1151799070 17:76366839-76366861 AGAGAGAAAGAGAAAAATGAGGG - Intronic
1152168511 17:78726970-78726992 AGAGAGAACTGGAAAGAGGATGG - Intronic
1153320808 18:3772317-3772339 AGAGAGAAGGAGAGAAAGGAAGG - Intronic
1153864817 18:9255967-9255989 AGAGAAAAGTAGAGAAAAGATGG + Exonic
1153971824 18:10234104-10234126 AGAGAGGAGTAGAGAGAAGGAGG + Intergenic
1154009314 18:10561660-10561682 AGAGAGAGGCAGACAAATGAGGG - Intergenic
1154370632 18:13758943-13758965 AGAGGGAGGGAGAGAGATGAGGG + Intronic
1155397557 18:25402824-25402846 AGAGAGCAGGAGACAGTAGATGG + Intergenic
1155565212 18:27126895-27126917 AGAGAGAAGTAGACACACTTGGG + Intronic
1155627725 18:27854024-27854046 AGAGAGAAGAAGAAAGAGGAGGG + Intergenic
1155980242 18:32172001-32172023 AGAGAAATGTTGAGAGATGAGGG - Intronic
1156460369 18:37318302-37318324 TGAGAAAAGTAGAGAGGTGAGGG - Intronic
1156519357 18:37708727-37708749 ATAGAGAAGTGGAGAGAGGAAGG - Intergenic
1156534177 18:37847035-37847057 AGAGGGATGTGCACAGATGAAGG + Intergenic
1156788933 18:40948859-40948881 AGAGAAGGGCAGACAGATGAGGG + Intergenic
1156898745 18:42276257-42276279 AGAGAGAAAGAGAGAGAGGAAGG - Intergenic
1157002917 18:43549044-43549066 AGAGAGAGGGAGAGAGAGGAAGG + Intergenic
1157129795 18:44996140-44996162 AGAGAGAAGAAGAGAAAAGAGGG - Intronic
1157139904 18:45095294-45095316 ACAGAGAAGTGAGCAGATGAGGG - Intergenic
1157938853 18:51903714-51903736 TGAGAGAAAGAGAGAGATGAAGG + Intergenic
1158374647 18:56849094-56849116 AGAGATAAGGAGATAGATGAAGG - Intronic
1158669935 18:59465327-59465349 AGAGAGAAGAAGAAAGAGAAAGG - Intronic
1158758425 18:60354460-60354482 AAAGAGAAGGAGGCAAATGAAGG - Intergenic
1158807923 18:60997693-60997715 AGAGAGAAAGAGGCAGATGCAGG + Intergenic
1158854485 18:61529293-61529315 TGAGAGAAGCAGCCAGCTGACGG - Intronic
1159175627 18:64829840-64829862 AGGGAGAGGTAGAGAGATGGGGG + Intergenic
1159258175 18:65976043-65976065 AGAGAGAGATGGAGAGATGAGGG - Intergenic
1159479914 18:68976692-68976714 TGAGAGAAATAGACATATGATGG - Intronic
1159755324 18:72356948-72356970 AGAGAGAAAGAGAGAGATGCAGG - Intergenic
1159756059 18:72367594-72367616 AGAGAGAAGGAGAAAGTGGAAGG + Intergenic
1160120188 18:76123061-76123083 AGAGAGAGAGAGAGAGATGAGGG + Intergenic
1160288896 18:77572268-77572290 AGAGAGATGGAGACAGCTGAGGG + Intergenic
1161243265 19:3234784-3234806 AGAGAGAAGTGGGCAGATTCTGG - Intronic
1161560763 19:4971354-4971376 GGAGAGAAGGACACAGAGGACGG - Intronic
1161918733 19:7250327-7250349 AGAGAGAAAAAGAAAGAGGAGGG + Intronic
1162400771 19:10445275-10445297 GGTGAGAAGTAGACAGATTCTGG + Intronic
1162526666 19:11210331-11210353 ACAGATAAGGAGACAGGTGAAGG - Intronic
1162526771 19:11210774-11210796 ACAGATAAGGAGACAGCTGAAGG - Intronic
1162578485 19:11513395-11513417 AGAGAGAATTAGAAAGAAAAAGG + Intronic
1162705987 19:12555272-12555294 AGAGAGAAAGAGAAAGAAGAAGG + Intronic
1162874826 19:13613286-13613308 AGAGAGAACAAGAGAGAGGAGGG - Intronic
1163175878 19:15563839-15563861 AGAGAGAAAGAGAGAGAGGAAGG - Intergenic
1163779788 19:19240173-19240195 AGGGAGAAGGAGAGAGATGAGGG - Intronic
1164190597 19:22913655-22913677 AGAGAGTAGTACACAAATGGAGG - Intergenic
1164501820 19:28826840-28826862 AGAGAGCAGTAGACAAATTAAGG - Intergenic
1165087257 19:33359225-33359247 AGAGAGAAGTAAACAGTGTAAGG - Intergenic
1165331734 19:35144105-35144127 AGAGAGAAGCAGAGAGACGGAGG + Intronic
1166090350 19:40504368-40504390 AGAGAGAAATAGAAACATGCTGG + Intronic
1166382832 19:42363672-42363694 AGAGAGAAAGAGAGAGAGGAGGG - Intronic
1166401358 19:42482925-42482947 AGAGAGAACGAGAGAGATGGAGG - Intergenic
1166551060 19:43666528-43666550 AGAGAGAAAGAGAGAGAGGAAGG - Intronic
1167194295 19:48016571-48016593 AGAAAGAAAGAGAGAGATGAAGG - Intronic
1167419031 19:49392154-49392176 GGAGAGATGGAGACAGAGGAAGG + Intronic
1167570600 19:50286364-50286386 AGAGAGAAAGAGACAGACAAAGG - Intronic
1167643428 19:50694161-50694183 AGAGAGAAATGGAGAGATGGTGG - Intronic
1167963866 19:53128131-53128153 GAAGAGAAGTAGAAAAATGAGGG - Intronic
1168189500 19:54727433-54727455 AGAGGGAGGGAGACAGATGGAGG + Intronic
1168190307 19:54733588-54733610 ACAGAGAAATAGAAAAATGATGG - Intronic
1168201626 19:54819535-54819557 AGAGGGAGGAAGACAGATGGAGG + Intronic
1168236668 19:55068026-55068048 AGAGAGAAGGAGACACAGGAGGG - Intronic
1168711007 19:58499884-58499906 AGAGAGAAGTATAGAGAAGGCGG + Intronic
1202641240 1_KI270706v1_random:89123-89145 AGACAAAAGTAGATAGATGGTGG + Intergenic
925000853 2:401789-401811 AGAAACAAGAAGAGAGATGAAGG - Intergenic
925289815 2:2740001-2740023 AGAGAGAAGGAGGCTGATGGAGG + Intergenic
925381705 2:3432336-3432358 ATAGAGGAGCAGACAGCTGATGG - Intronic
926013510 2:9427252-9427274 AAATAGAAGGAGACAGATGTGGG + Intronic
926051043 2:9745005-9745027 AGATAGAAGTCGGCAGAAGAGGG - Intergenic
926689125 2:15720763-15720785 ATAGACAAGTAAACGGATGATGG - Intronic
927246272 2:20959360-20959382 AGAGAGAAGGAGACAGATTTTGG + Intergenic
927307577 2:21591097-21591119 AGAGAGAGGTAGAGAAATAAAGG + Intergenic
928256750 2:29729340-29729362 AGAGAAAAGAAGAGAGAGGAAGG + Intronic
928812462 2:35246266-35246288 TGATAGAAGTAGTCAAATGAGGG - Intergenic
929223230 2:39486655-39486677 AGAGAGAGGAAGGGAGATGAGGG + Intergenic
929403704 2:41615306-41615328 AGAGAGAAATAGACAGTAGCTGG + Intergenic
929623758 2:43385088-43385110 AGAGAGCAGTAGTGAGATGTTGG - Intronic
929667723 2:43846271-43846293 AGTGAGAAGTGGGCAGATGCTGG + Exonic
929741859 2:44610985-44611007 AAAGAGAAGTAGATAGAGAAGGG + Intronic
929931348 2:46258509-46258531 AGAGAGAAGGAGGAAGAGGAGGG + Intergenic
930352682 2:50277525-50277547 AGAGAGAAGAAGAGAAAGGAAGG - Intronic
931096247 2:58943844-58943866 AGAGAGAAGTAGAGAGGGAAGGG - Intergenic
931785931 2:65619478-65619500 CGAAGGAAGAAGACAGATGAGGG - Intergenic
931895265 2:66721756-66721778 AAGGAGAAGAAGAGAGATGAGGG - Intergenic
932509926 2:72276044-72276066 AGAGAGATGGAGATAGAGGAGGG + Intronic
932871575 2:75405230-75405252 AGAGAGAAGGAGATTTATGATGG - Intergenic
932882381 2:75515821-75515843 GGAGAGATGGAGACAGAAGAAGG - Intronic
933048200 2:77565982-77566004 GAAGAGAAGGAGAGAGATGAGGG - Intronic
933488658 2:82955951-82955973 AGAGAGAAGAAGAAAGAGGAAGG + Intergenic
933664062 2:84950476-84950498 AGAGAGAAAGAGAGAGAGGAAGG + Intergenic
933986234 2:87594492-87594514 AGAGAGAAAGAGAGAGATTAAGG - Intergenic
934121426 2:88843927-88843949 AGAGATAGGGAGGCAGATGAGGG - Intergenic
934128044 2:88917526-88917548 AAAGAGTAGAAGACAGAGGATGG - Intergenic
935293771 2:101630742-101630764 AGAGTGAAGTAGGCAGAGCATGG - Intergenic
935701620 2:105817200-105817222 AATGAGATGCAGACAGATGAAGG + Intronic
936307601 2:111356311-111356333 AGAGAGAAAGAGAGAGATTAAGG + Intergenic
936907819 2:117557160-117557182 AAAAGGAAGTAAACAGATGATGG + Intergenic
937610013 2:123849970-123849992 AGAGGGAAAGAGACAGATAAAGG + Intergenic
937731823 2:125241762-125241784 AGAGATGAGTAGATAGAAGAGGG + Intergenic
938655458 2:133427352-133427374 AGACAGAAGTACACAAAAGAAGG + Intronic
938901896 2:135805419-135805441 AGACAGACGCAGACAGAAGATGG + Intronic
939095921 2:137833253-137833275 AGAGAGAAGGATAGAGAGGAAGG - Intergenic
939171718 2:138703832-138703854 AAACAGGAGTAGACACATGATGG - Intronic
939652357 2:144779560-144779582 AGAGAGAAAGAGAGAGATGAGGG - Intergenic
940184816 2:150972203-150972225 AGGGAGAGGAAGAGAGATGAGGG + Intergenic
940330520 2:152469402-152469424 AGAGAAAAGTAGTCAGAAGTAGG - Intronic
940378439 2:152985659-152985681 AGAGGGAAAGAGGCAGATGAAGG - Intergenic
941201899 2:162521938-162521960 AGAGAGAAGTAGTAGAATGATGG - Intronic
941226650 2:162857866-162857888 AGAGAAAAATAGAAAGAGGAAGG + Intergenic
941357680 2:164513082-164513104 AGAGAGAAGTAGAGAGAGAGGGG - Intronic
942223269 2:173791845-173791867 AGAGAGAAAGAAACAGAGGAAGG - Intergenic
942295929 2:174517273-174517295 TGAGAGAAGTAGGCATCTGATGG + Intergenic
942910470 2:181237492-181237514 AGAGAAAAGAAGACAGATTCGGG + Intergenic
943835915 2:192513727-192513749 TGAGAGAAGTGGAAATATGAAGG - Intergenic
944605496 2:201348382-201348404 AGAGAGCAGAAGTCAGATGGTGG - Intronic
946352550 2:219164884-219164906 AGGGAGAGGCAGACAGTTGAAGG - Intronic
946540410 2:220678100-220678122 AGAGAGAAGCTGCTAGATGATGG - Intergenic
946872621 2:224098058-224098080 AGAGAGAGAGAGAGAGATGAAGG + Intergenic
947150686 2:227112128-227112150 CGATAGAAGTAGACAGAGGCTGG - Intronic
947329352 2:229012490-229012512 AGAGAAAATTAGACACAAGATGG - Intronic
947356342 2:229299951-229299973 AAAGAGTAGGAGAAAGATGAAGG - Intergenic
947361002 2:229345341-229345363 AGAGAGCAGAAGCAAGATGAAGG - Intergenic
947514449 2:230789878-230789900 TGAGAGAAGGAAACAAATGAGGG - Intronic
947548425 2:231028928-231028950 AGAGAGAAGTAGATAGACCCTGG - Intergenic
947874189 2:233457682-233457704 AGAGAGAATTGCACAGATGAAGG + Intronic
947941921 2:234064238-234064260 AGAGAGAGAGAGACAGAGGAAGG - Intronic
947977458 2:234379424-234379446 GGAGTGAAGTAGAAAGATCAAGG + Intergenic
948237783 2:236403318-236403340 AGAGAGAGGCAGAGAGAAGAGGG + Intronic
948513627 2:238489246-238489268 AGAGAGGAGGAGGCAGAAGATGG - Intergenic
1169525989 20:6426259-6426281 AGAGAGAAGAAGAAAGAGAAGGG - Intergenic
1169931176 20:10834718-10834740 AGACAGAAGGAAACACATGAGGG + Intergenic
1169932846 20:10852855-10852877 TGAGAGAAGGAGACAGCTTAAGG + Intergenic
1169964215 20:11196932-11196954 AGACTGAGGTAGAGAGATGATGG + Intergenic
1170370210 20:15640016-15640038 AGAGAGAAGGAGAGAGAAAAGGG + Intronic
1170541375 20:17391891-17391913 AGAGAGAAAGAGAGAGAGGAAGG + Intronic
1171056202 20:21909305-21909327 AGGTAGAAATAGACATATGATGG + Intergenic
1171545775 20:25999593-25999615 AGAGAGAAAAAGACAGAGAAAGG + Intergenic
1171812374 20:29755560-29755582 AGAGAGAGACAGACAGATGGAGG + Intergenic
1171888345 20:30679334-30679356 AGACAAAAGTAGATAGATGGTGG + Intergenic
1172606917 20:36220231-36220253 AGGGAGGAGAAGACAGATGCGGG + Intronic
1173012753 20:39197084-39197106 AGAGTGATGAAGACAGATTAGGG - Intergenic
1173253538 20:41377043-41377065 AGAGAGAGGGAGAAAGATGGCGG + Intergenic
1173410558 20:42805914-42805936 AAAGAGGATTTGACAGATGAGGG - Intronic
1173542469 20:43864472-43864494 AGATGGAAGTAGACAGAGGGAGG - Intergenic
1173882526 20:46427192-46427214 GGAGAGAAGTATAGAGATAAGGG - Intronic
1174158677 20:48534787-48534809 AGAAAGAAGTGGAGAAATGAGGG + Intergenic
1174398214 20:50260911-50260933 AGAGAGAAGTTGTCTGATGCTGG - Intergenic
1174423489 20:50415972-50415994 AGAGAGAAGGAAACAGAGGGAGG + Intergenic
1175037117 20:56010216-56010238 AGAGAGAAAGAGAGAGATGGGGG - Intergenic
1175449055 20:59046979-59047001 AAAGAGAAGAAGACAGTTGAAGG - Intergenic
1175599698 20:60263250-60263272 AGAAGGAGGTAGACAGAGGAGGG - Intergenic
1175849766 20:62083552-62083574 AGAGAGAAGGAGAAAGAGGAGGG - Intergenic
1175921348 20:62451857-62451879 AGAGAGAAAGAGAGAGAGGAGGG + Intergenic
1177072970 21:16534153-16534175 AAGGAAAAGGAGACAGATGAAGG + Intergenic
1177565112 21:22810612-22810634 AGATAGAAGAAGAGAAATGAAGG + Intergenic
1178147816 21:29759794-29759816 AGGGAGGAGTAGACAGCAGAGGG - Intronic
1178855187 21:36244872-36244894 AGACAAAAGTAGACAAAGGAAGG - Intronic
1178898097 21:36577124-36577146 AGAGAGATATACACAGATGGTGG + Intergenic
1179081847 21:38178699-38178721 AGAAAGAAGAAGAAAGAAGAAGG + Intronic
1179367803 21:40774289-40774311 AGAGAGACATAGACAGAGGCTGG + Intronic
1180360721 22:11892752-11892774 AGACAAAAGTAGATAGATGGTGG - Intergenic
1180438343 22:15336517-15336539 AGAGACAAATAAACAGATGATGG + Intergenic
1181030462 22:20146977-20146999 AGAGAGAAGCAGAAAGGTGGAGG - Intronic
1181373821 22:22440438-22440460 AGTGAGCAGTGAACAGATGATGG - Intergenic
1182049010 22:27299149-27299171 AGAAAGAAAGAGAGAGATGAGGG + Intergenic
1182855288 22:33511666-33511688 AGAGATAAGAAGACAGACTAGGG - Intronic
1182877198 22:33702517-33702539 AGAGGGAATTAGACAGTCGAAGG + Intronic
1183274204 22:36881849-36881871 GGAGAGAAGGAGACAGAAAAAGG + Intergenic
1183352270 22:37340973-37340995 GGAGAGAAATAGACAGATGGAGG + Intergenic
1183367911 22:37416976-37416998 AGAGAGGAGGAGACAGAGAAAGG - Intronic
1184863838 22:47191849-47191871 AGAGAGAGGGAGAGAGAGGAAGG + Intergenic
1185102627 22:48849861-48849883 AGAGAGAAATAGAGAGATAAAGG + Intronic
1185139884 22:49094210-49094232 AGAGGGAAATAGAGAGAGGAAGG + Intergenic
949317513 3:2773199-2773221 AAAGAGAAGTGCACAGCTGAAGG + Intronic
949758116 3:7437316-7437338 AGAGAGAAGTGGATAGAGAAAGG - Intronic
951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG + Intronic
951529237 3:23683243-23683265 AGAGAGAGAGAGAGAGATGAAGG + Intergenic
952041692 3:29268790-29268812 AGAGGGAAGAAGCCAGAGGAAGG + Intergenic
952135972 3:30420092-30420114 AGAGAGAAGTAGGGTGATGATGG + Intergenic
952492033 3:33882258-33882280 GGAGAGCAGTGGTCAGATGAGGG + Intergenic
952636701 3:35541823-35541845 AAAGAGAAATAAACAGATGATGG + Intergenic
953041540 3:39258987-39259009 AGAGAAAAGAAGAGGGATGAGGG - Intergenic
953137303 3:40192253-40192275 AGGGAGAATTAGAAAGGTGAGGG - Intronic
953173567 3:40529266-40529288 AGTGAGAAGTAGAAGGAAGAAGG - Intronic
953256037 3:41291423-41291445 AGAGAGAAGGAGAGAGAAGGAGG + Intronic
953827402 3:46265769-46265791 AGGGAGAACGAGACAGAAGATGG - Exonic
955017333 3:55085055-55085077 AGAGAGAGCTAGAGAGAAGAAGG + Intergenic
955848165 3:63190678-63190700 AGAGAGAAGGAGAAAGAGGGAGG + Intergenic
955964713 3:64377116-64377138 AGAGGGAAGCAGACAGAGAAAGG + Intronic
956007166 3:64792432-64792454 GGAGAGAAGTACGCAGATTAGGG + Intergenic
956055368 3:65293046-65293068 AGAAATGAGTAGACAGTTGATGG + Intergenic
956456757 3:69429134-69429156 GGAGAGAAGTGGATAAATGATGG - Intronic
956794080 3:72702509-72702531 AGAGAACAGACGACAGATGAGGG - Intergenic
956846513 3:73188737-73188759 AGAGAGAGGGAGAGAGAGGAGGG - Intergenic
956850999 3:73228113-73228135 AGAGAGAGGGAGAGAGAGGAGGG - Intergenic
956961248 3:74403861-74403883 AGAGAAGAGTAGACAGAGCAGGG - Intronic
957194011 3:77044593-77044615 AGAGTGAAGAAGATAGGTGAGGG + Intronic
957562910 3:81846864-81846886 AGGGAGAAGTAGACATCTGAAGG + Intergenic
959484856 3:106915323-106915345 GGAGAGAACTAGGCACATGAGGG - Intergenic
959643644 3:108671533-108671555 AGAGGGAAGGAGGAAGATGATGG - Intronic
959784449 3:110276783-110276805 AGAGAGAAAGAGAGAGAAGAAGG - Intergenic
959859718 3:111203691-111203713 TGAATGAAGTTGACAGATGAAGG - Intronic
959978662 3:112489852-112489874 AGAGAGGAGGGGAGAGATGATGG + Intronic
960086612 3:113597721-113597743 TCAGTGAAGTAGACAGATGCAGG + Intronic
960238223 3:115309771-115309793 AGACAGAAGTAGATTGGTGATGG - Intergenic
960270886 3:115673232-115673254 AGAGAGAAAGAGAAAGAGGAGGG + Intronic
960447210 3:117763190-117763212 AGAGAGAAGCAGAGAGGGGAAGG + Intergenic
961408573 3:126701703-126701725 AGAAAGAAGCAGAAAGCTGAAGG - Intergenic
961443135 3:126964731-126964753 AGAGAGAAATGCACAGGTGAGGG + Intergenic
962063573 3:131955451-131955473 AGAGAGAAGGAGGCAGCTGAGGG - Intronic
962120557 3:132556090-132556112 TGAGAGAAGTGAACAGAGGAGGG + Intergenic
962560311 3:136599560-136599582 AGAGGGAAGAAAAGAGATGAAGG - Intronic
962626547 3:137231103-137231125 AGAATGAAGGAGGCAGATGAGGG + Intergenic
962653375 3:137518136-137518158 AGAGGGAAGGAGAAAGATAAGGG - Intergenic
962902836 3:139776030-139776052 AGAGAGAAGGAGAGAGACAAGGG + Intergenic
963125288 3:141810378-141810400 AGAGAGAGGGAGAGAGAGGAAGG - Intronic
964188732 3:153978115-153978137 AGAGACAAGAAGACAGGAGAAGG + Intergenic
964500890 3:157347390-157347412 AGAGAGATGTAGAGAGAAGATGG + Intronic
964622316 3:158730411-158730433 AGAGAGAAAGAGAGAGAGGAAGG - Intronic
964663807 3:159150838-159150860 AGAGCTGAGTAGGCAGATGAAGG - Intronic
965188513 3:165498815-165498837 AGAGAGAGGGAGAGAGACGAAGG + Intergenic
965272099 3:166630177-166630199 AGAGAGAGAGAGAGAGATGAAGG - Intergenic
965709779 3:171545608-171545630 AGAGAGAAAGAGACAGAGCATGG - Intergenic
965752816 3:171994298-171994320 AGAGAGAAGCAGAGAGAATAAGG + Intergenic
965781084 3:172286860-172286882 AGTGAGAAGAAGATAGATGCAGG + Intronic
965932644 3:174065316-174065338 AGAGAGAAAGAGACAGATTAAGG + Intronic
966377153 3:179308029-179308051 AGAGAGAATTAGAGAGATTCTGG - Intergenic
966450168 3:180050052-180050074 AGAAAGAAGTAACCAGCTGAGGG - Intergenic
966547443 3:181166473-181166495 AGAGAGAAGTAGACAGCTGTGGG + Intergenic
966837421 3:184059821-184059843 AGGGCGAAGTAGACACCTGAGGG - Exonic
967114688 3:186326442-186326464 AGAGAGAGAGAGAGAGATGAGGG - Intronic
967336011 3:188345504-188345526 AAAAAAAAGAAGACAGATGAGGG + Intronic
967589308 3:191253978-191254000 AGATAGAAATAGACAAAAGATGG + Intronic
967684388 3:192402401-192402423 GGAGAGAAGTGGAAAGCTGATGG - Intronic
1202737328 3_GL000221v1_random:18234-18256 AGACAAAAGTAGATAGATGGTGG - Intergenic
968607188 4:1541101-1541123 AGAGAGCAGCAGACAGAGCAGGG + Intergenic
969182523 4:5453203-5453225 AGAGAGAATTACAGAGATTAGGG + Intronic
969963345 4:10969541-10969563 AAAGAGAAGGAGAGAGAGGAAGG - Intergenic
970196251 4:13553101-13553123 AGAGAGAAACAGATAGATGGGGG - Intergenic
970774107 4:19652285-19652307 AGAGTGAACTAGAGAGATGGTGG - Intergenic
971014365 4:22471749-22471771 AGAGATAAATATACAGATAAGGG - Intronic
971090549 4:23338713-23338735 AGAGAGAAGAAAACTGATGTAGG + Intergenic
971226115 4:24752818-24752840 AAAGAGAGGGAGACAGCTGAGGG + Intergenic
971864211 4:32147734-32147756 AGAGAGAGAGAGACAGAGGAGGG + Intergenic
972081068 4:35150279-35150301 GTAGATAAATAGACAGATGATGG + Intergenic
972457911 4:39272388-39272410 GGAGAGAAGCAGACAGATGTGGG - Intronic
972829179 4:42794308-42794330 AGACATAACTAGACAAATGAAGG - Intergenic
973384751 4:49499650-49499672 AGACAAAAGTAGATAGATGGTGG + Intergenic
973638157 4:52878824-52878846 AGAGAAAAGTAGACGTATGATGG - Intronic
973968610 4:56188856-56188878 AGAGATAGGTATTCAGATGAGGG - Intronic
974405795 4:61467491-61467513 AGAGAGAGAGAGAGAGATGAAGG + Intronic
974424975 4:61730590-61730612 AGAGAGAAGTAAAGAGAGAAAGG - Intronic
974592268 4:63968853-63968875 AGATATAAATAGACAGATAAAGG + Intergenic
975430853 4:74289293-74289315 AGGGAGTCGTGGACAGATGAGGG + Intronic
975468108 4:74732958-74732980 AGAGAGAAAGAGAGAGAGGATGG + Intergenic
975631437 4:76407815-76407837 AGAGAAAAGAAGAAAGAGGAAGG + Intronic
976300671 4:83512800-83512822 AGAGAGCAGTATACTGTTGAGGG - Intronic
976597312 4:86906246-86906268 AGAGAGAAATAGAAACATGCAGG - Intronic
976598620 4:86917313-86917335 AGAGAGAGAGAGAGAGATGAAGG + Intronic
976714806 4:88112419-88112441 AGAGAGAAGTAGGGAGAAGAAGG - Intronic
976742322 4:88368982-88369004 AGAAAGAAGTAGATAGAAAATGG + Intergenic
976780290 4:88750826-88750848 AACGAGAGGTAGACAGATGATGG - Intronic
976806669 4:89054940-89054962 AGAGAGAAGTAGGGAGCTGCAGG - Intronic
977080257 4:92518106-92518128 AGAGAGAAAGAGAGAGAAGATGG - Intronic
977145720 4:93437966-93437988 AGAGAGAACGAGAGAGATGGAGG + Intronic
977547935 4:98407670-98407692 AGAGGGAGGTAGTGAGATGAGGG + Intronic
977780875 4:100979269-100979291 AGAGAGAAATAGAAAAATTATGG - Intergenic
978068061 4:104430896-104430918 AGAGAGAAAGAGAGAGAGGATGG - Intergenic
978237918 4:106482380-106482402 AGAGAGGAGGAGACAGGTCAGGG + Intergenic
978672909 4:111272680-111272702 AGAAAGAAGTAAACAGAGAAAGG - Intergenic
978968481 4:114772485-114772507 AGGGAGAAGTAGACATATCTCGG - Intergenic
979337563 4:119480777-119480799 AGAGAGAAGCAAAAACATGAAGG - Intergenic
980418434 4:132524181-132524203 AGAGAGAAGTGTACAAATGTTGG - Intergenic
980750322 4:137078725-137078747 AGAGGGGAGTAGGGAGATGAAGG - Intergenic
980816836 4:137958783-137958805 GGAGAGAAGGAGACAGGTGATGG - Intergenic
981500625 4:145447665-145447687 AGAGAGAGGTATACAAAAGATGG + Intergenic
981652245 4:147073258-147073280 AGTGAGAAGTAGTCAGATTCAGG + Intergenic
981658286 4:147137171-147137193 GGAGAGAACTAGGCAAATGAGGG - Intergenic
981695949 4:147558906-147558928 AGAGAGAAGGAGAAAGATTGAGG + Intergenic
982129133 4:152211554-152211576 AGAGAGAGAAAGACAGACGAAGG + Intergenic
982131735 4:152234789-152234811 AGACAGAAGTTGGCAAATGATGG - Intergenic
982627720 4:157788536-157788558 ACAGAGAAGTAGTGAGATGGGGG - Intergenic
982882089 4:160731948-160731970 AGAGAGAAAGAGACAGAGGGAGG - Intergenic
983662833 4:170147633-170147655 AGAGAGAGAGAGAAAGATGATGG - Intergenic
983911518 4:173244746-173244768 AGAAAGAAGTGGCCAGATGGAGG + Intronic
984523054 4:180823745-180823767 AGAGAGAAGGAGAGAGAGGGAGG - Intergenic
985237498 4:187892012-187892034 ATGGATAAGTAGACAGAGGAAGG + Intergenic
1202768606 4_GL000008v2_random:174982-175004 AGACAAAAGTAGATAGATGGTGG + Intergenic
986309862 5:6543944-6543966 AGAGAGAGAGAGACAGAGGAGGG - Intergenic
986563524 5:9087003-9087025 AGAGAGAAGTCCACAGAAGTGGG - Intronic
986592557 5:9386547-9386569 TGGGAGGACTAGACAGATGAGGG - Intronic
987448910 5:18056835-18056857 AGAGAGAGGGAGACAGAGAAGGG + Intergenic
988832748 5:35003478-35003500 AGATAGAGGCAGACAGAGGATGG - Intronic
989374491 5:40746829-40746851 TGAGAAAAGTAAACAGCTGAAGG - Exonic
989842873 5:46102655-46102677 AGAGAGAAAGAGAGAGAAGAAGG + Intergenic
990122034 5:52466782-52466804 AGAGAGAAAGAGAAAGAAGATGG - Intergenic
990537831 5:56740925-56740947 AGAGAGAAGAAAACAAATGTTGG + Intergenic
990636082 5:57728621-57728643 AGAGAGAAGAAGAAAGCTGGAGG - Intergenic
991320407 5:65367488-65367510 AGAGAGGACTAGATAGCTGAGGG - Intronic
991348269 5:65693231-65693253 AGAGAGAAAGAGAGAGAGGAAGG + Intronic
992056163 5:72992937-72992959 AGAGAGAAGAAGAGAAAAGAGGG + Intronic
992407470 5:76473444-76473466 AGAGAGAAGGAGAAAGAGGGAGG - Intronic
992743688 5:79798346-79798368 AGATGGAAGAAGAGAGATGAGGG - Intronic
993001484 5:82385704-82385726 AGAGAGAAGCAGAGAGAAGAGGG - Intronic
993152075 5:84174037-84174059 AAAGGAAAGGAGACAGATGAGGG + Intronic
993330509 5:86594491-86594513 AGAGAGAAAAAGAAAGAGGAAGG + Intergenic
993488310 5:88514335-88514357 AGAAAGAAATAAACAGAGGAAGG + Intergenic
994011451 5:94907798-94907820 AGAGAGAAGAAGGGATATGAAGG + Intronic
994050020 5:95351813-95351835 AGAGATAAATATACAGATGATGG + Intergenic
994170631 5:96656451-96656473 AGATAGGAGGAGACAGAAGAGGG - Intronic
994958901 5:106572292-106572314 AGAGAGAGAGAGAGAGATGAGGG + Intergenic
995101439 5:108311835-108311857 AAAGAGAAGAAGAGAGATAATGG + Intronic
995130182 5:108622141-108622163 ACAGAGAAGTAAACAAATTATGG + Intergenic
995957584 5:117796674-117796696 AGAAAGAAGTGGACAGAAGTGGG - Intergenic
996148120 5:120000005-120000027 AGGGAGAAGGAGATAGAGGAAGG + Intergenic
996279079 5:121705595-121705617 AGAGAGAGGGAGAGAGAGGAAGG + Intergenic
996315800 5:122159401-122159423 AGAGTGATGAACACAGATGAAGG + Intronic
996453836 5:123657352-123657374 AGAGAGAAAGAGACAGAGTAAGG + Intergenic
996518419 5:124399341-124399363 AGAGAGAGAGAGAGAGATGAAGG - Intergenic
996633830 5:125666976-125666998 AGAGAGAAAGAGAGAGAGGAGGG + Intergenic
997286010 5:132679082-132679104 AGAGATAAGTGCACAGATCAGGG - Intronic
998182106 5:139953045-139953067 AGAGAGAAGAAGAAAGAGCAAGG + Intronic
998399782 5:141842660-141842682 CCAGAGAAGTAGAGAGAAGAGGG + Intergenic
998817683 5:146030528-146030550 CTACAGACGTAGACAGATGAGGG - Intronic
998880839 5:146643199-146643221 AGAGAGAGGGAGACAGACAAGGG + Intronic
998921332 5:147071468-147071490 TGAAAGATGGAGACAGATGATGG - Intronic
999082748 5:148859520-148859542 AGGCACAAGTACACAGATGAAGG - Intergenic
1000255870 5:159537722-159537744 AGAGGGAAGTAGAAAAATGAAGG - Intergenic
1001459196 5:171894501-171894523 AGAGACACGGAGCCAGATGAGGG + Intronic
1001920910 5:175598799-175598821 ACAGTGAAGTAGTCAGATGCTGG + Intergenic
1001943058 5:175754221-175754243 GGAGAGAAGCAGGCAGATGGTGG - Intergenic
1002315385 5:178340026-178340048 AGAGATGAGTAGAGGGATGAGGG + Intronic
1002548913 5:179972575-179972597 AGTGAGAGGTATCCAGATGAGGG + Intronic
1002635531 5:180606179-180606201 AGTCAGAAGAAGACACATGATGG - Intronic
1002987665 6:2206430-2206452 AGAGACAAGTAGACCTATGAAGG - Intronic
1003017314 6:2478489-2478511 AGGGAGAAAGAGAAAGATGAAGG - Intergenic
1003293772 6:4805738-4805760 ACAAAGAGGTAGACAGAGGAAGG - Intronic
1003408099 6:5839670-5839692 AGAGTGAAGATGACAGCTGAGGG + Intergenic
1003460345 6:6322769-6322791 AAAGAGAAGTAGCCATATAAGGG - Intergenic
1003463400 6:6353193-6353215 AGAGAGAGAGAGACAGATAATGG - Intergenic
1003676072 6:8205728-8205750 ATAGAGAAGTAGGCAAACGATGG + Intergenic
1004184370 6:13409350-13409372 AGAGAGAAAGAGACAGAGGAAGG + Intronic
1004252858 6:14036262-14036284 AAAGAGAAGTACTGAGATGAGGG - Intergenic
1004539844 6:16539483-16539505 AGAGAGGAGCAGAGAGATAAAGG + Intronic
1004886390 6:20055049-20055071 AGAGAGAAGCAGCCACATGATGG + Intergenic
1005175169 6:23036463-23036485 AGAGAGAGTTATTCAGATGAAGG + Intergenic
1005330924 6:24749383-24749405 AGAAAGAAAGAGACAGATGGTGG + Intergenic
1006277588 6:33018049-33018071 AGAGTAAAGAAGAAAGATGAGGG - Intergenic
1006297468 6:33176319-33176341 GGATAGAAGTAGACTGATCAGGG + Intronic
1006426771 6:33968276-33968298 AGGGAAAAGTGGACAGATGCAGG - Intergenic
1006532198 6:34665456-34665478 AGAGAGAAGGAGAGATATGGGGG + Intronic
1006572474 6:35017308-35017330 GGAGAGAAGAAGAGAGAGGAAGG - Intronic
1006709136 6:36050278-36050300 AGGGAGATGAAGACAGAAGAGGG + Intronic
1007452609 6:41951603-41951625 AGAGAGAAGCAGGAAGAAGAGGG + Intronic
1007522841 6:42465689-42465711 AGAGAGAGAGAGACAGAGGAAGG - Intergenic
1008319919 6:50098417-50098439 ACAGTGAAGTATAGAGATGAAGG + Intergenic
1008447779 6:51613095-51613117 AGAAAGAAAGAGAGAGATGAAGG + Intergenic
1009310288 6:62142115-62142137 AGAGAGAAGAGTACTGATGAGGG + Intronic
1009319864 6:62274192-62274214 AGGGAAAAGTAGACAGATCTAGG - Intronic
1010207634 6:73337161-73337183 ACAGAAAAGTATAAAGATGAAGG - Intergenic
1010288830 6:74112046-74112068 AGGGAGAAGGAGAAAGATGAAGG - Intergenic
1010335256 6:74674039-74674061 AGAGAGGAGAAGAGAGAGGAAGG - Intergenic
1010685084 6:78845044-78845066 AGACACAACTAGACAGCTGAAGG + Intergenic
1010943379 6:81946570-81946592 AGAGAGAGGAGGACAGAGGAAGG + Intergenic
1011346567 6:86375957-86375979 AGAGATGAGTAGACACAAGATGG - Intergenic
1011421171 6:87175167-87175189 GGAGAGAAGAAGTCAGAGGAAGG - Intronic
1011580501 6:88858800-88858822 TGAGAGAAGAAGAGAAATGAGGG + Intronic
1011749772 6:90443337-90443359 AGAGGCAAGGAGACAAATGAGGG + Intergenic
1011797508 6:90973108-90973130 AGAGAAAAGTAGCCAAAAGAAGG - Intergenic
1011813570 6:91161403-91161425 TTAGAGAAAAAGACAGATGACGG - Intergenic
1011949128 6:92942557-92942579 AGAGAGAAAAAGAAAGAGGAAGG - Intergenic
1012085597 6:94822356-94822378 AGAGAGAAGGAGAGAGAGAAGGG - Intergenic
1012085605 6:94822422-94822444 AGAGAGAAGGAGAGAGAGAAGGG - Intergenic
1012118296 6:95332930-95332952 AAAGAGAAGGAGTAAGATGAGGG + Intergenic
1012581553 6:100876127-100876149 AGAGAGACTTGGATAGATGAAGG + Intronic
1013327788 6:109064693-109064715 AGAGAGAGGGAGAGAGATGAAGG + Intronic
1013999889 6:116352919-116352941 AGAGAGAAAGAGAGAGAGGAAGG - Intronic
1014126147 6:117779325-117779347 AGAGGGAAGGAGATAGAGGAAGG - Intergenic
1014152674 6:118076523-118076545 AGAGAGACGGAGAGAGAAGAGGG + Intronic
1014488049 6:122025394-122025416 GGAGAGAAGTAGAAAGATATAGG + Intergenic
1014488385 6:122030168-122030190 AGATAAAAGTAGACATATGAAGG + Intergenic
1014787018 6:125630913-125630935 AGGGTGAAGTGGGCAGATGAAGG + Intergenic
1015141066 6:129932382-129932404 AGAGAGAAAAAGAAAGAGGAGGG + Intergenic
1015274599 6:131371206-131371228 AGAGAGACACAGACAGAAGAAGG + Intergenic
1015559391 6:134498123-134498145 GGAGAGAAGAAGAAAGAGGAAGG - Intergenic
1015771107 6:136769548-136769570 AGAGAGAAGTATACAGAAGTGGG + Intronic
1015956731 6:138606667-138606689 AAAAAGAAGTAGCCAGATGAAGG - Intronic
1015966834 6:138702688-138702710 AGAGAGAAAGAGACAGAGAAGGG - Intergenic
1016177079 6:141093549-141093571 AAAGAGAAGAACAAAGATGAAGG - Intergenic
1016271489 6:142295326-142295348 ACAGAGAAGTACACAGATTCAGG - Intergenic
1016645270 6:146399736-146399758 AGAGAGAAAGAGACAGAGAAAGG - Intronic
1016815909 6:148302858-148302880 AGAGAGAAAGAAAGAGATGATGG + Intronic
1016857061 6:148681413-148681435 AGATAGAAGAATACAGATGAAGG - Intergenic
1016906381 6:149154677-149154699 AGAGAAAAATAGACAGAGCAAGG - Intergenic
1017138835 6:151171968-151171990 AGAGAGAAAAAGAGAGAGGAAGG - Intergenic
1017557688 6:155589680-155589702 AGGGAGTAGTTTACAGATGAGGG + Intergenic
1018106605 6:160493345-160493367 AAAGAGAGCTAGACAGATGAAGG - Intergenic
1019328510 7:451470-451492 AGAGAGAGAGAGACAGATGGAGG - Intergenic
1019332363 7:466708-466730 AGAGTGAAGGAGAAAGGTGAAGG - Intergenic
1019495487 7:1337766-1337788 AGAAAGAAGGAGAGAGAGGAGGG - Intergenic
1019512308 7:1423853-1423875 GGAGAGAGGGAGACAGATGGAGG + Intergenic
1019797661 7:3063691-3063713 AGAAAGAAGAAGAAAGAAGAAGG - Intergenic
1019964085 7:4484702-4484724 AGAGAGAAGGGGAGAGAGGAGGG + Intergenic
1020011358 7:4807556-4807578 AGAGAGAAGGAGAGGGAGGAGGG - Intronic
1020011369 7:4807594-4807616 AGAGAGAAGGAGAGGGAGGAGGG - Intronic
1020173951 7:5867584-5867606 AGAGAAAAGGAGAAAGAGGAGGG - Intergenic
1021432174 7:20572520-20572542 AAAAAGAAGTGGGCAGATGAAGG + Intergenic
1021450557 7:20779647-20779669 AGAGAGAAGGATAAAGATGTTGG + Intergenic
1022186387 7:27973725-27973747 AGAAAGAAGTGGAGAGAAGAAGG + Intronic
1022525838 7:31036627-31036649 AGAGAGAGACAGAGAGATGAAGG - Intergenic
1023153995 7:37229476-37229498 ATAGAGAAGGAGACAGAGGCTGG + Intronic
1023310137 7:38878022-38878044 AGAAAGATGTAGAAAGATGGTGG - Intronic
1023747572 7:43335852-43335874 AAAGAGAAAGAGAGAGATGAAGG - Intronic
1024019870 7:45358892-45358914 AGAGAGAGAGAGAGAGATGATGG + Intergenic
1024066790 7:45744253-45744275 GGAGTGAAGTAGAGAGAGGAAGG + Intergenic
1024355920 7:48413225-48413247 AGACAGAAGCAGAAAGAGGAGGG - Intronic
1024791138 7:52965988-52966010 AGAGAGAAAGAGAGAGATGAAGG - Intergenic
1025247500 7:57328402-57328424 AGAGAGAAGAAAACAGAGGGAGG - Intergenic
1025297185 7:57784649-57784671 AGAGAGAAAGAGACAGAGAAAGG + Intergenic
1025626898 7:63230817-63230839 AGAGAGAGGGAGACAGAGGGAGG + Intergenic
1025626910 7:63230863-63230885 AGAGAGAGGGAGACAGAGGGAGG + Intergenic
1025860661 7:65324350-65324372 AGAAAGAAGAAAACAGTTGAGGG - Intergenic
1026080154 7:67210786-67210808 AGATAGACACAGACAGATGATGG - Intronic
1026679485 7:72454760-72454782 GGAGAGGAGGAGACAGCTGAGGG - Intergenic
1026696931 7:72603217-72603239 AGATAGACACAGACAGATGATGG + Intronic
1026857257 7:73762921-73762943 AGAGAGAAAAAGAAAGATGGGGG - Intergenic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1028302119 7:89213192-89213214 ACAGAGATGCAGAAAGATGATGG + Intronic
1028541926 7:91951975-91951997 CAAGGGAACTAGACAGATGAGGG - Intronic
1028696397 7:93717793-93717815 AGAGAGAGGGAGAGAGAGGAAGG + Intronic
1028770324 7:94612792-94612814 AGAGAGAAGAAGATAGAAGGAGG - Intronic
1028974858 7:96901554-96901576 AGACTGAAGTAGACACATGCCGG - Intergenic
1029014321 7:97299138-97299160 AGAGACAGGGAGACAGATTAGGG - Intergenic
1029026323 7:97420741-97420763 AGAGAGAGGGAGAGAGAGGAAGG + Intergenic
1029558421 7:101286476-101286498 AGAGATAAGCAGACATTTGAAGG - Intergenic
1029646605 7:101860788-101860810 AGAGAGAAGAAGAGAGGGGAAGG - Intronic
1029713665 7:102314038-102314060 AGAGACAAGTAGGCAGGAGAAGG + Intronic
1029720660 7:102362311-102362333 AGAGAGAAAGAGAGAGAGGAAGG - Intergenic
1030874582 7:114797400-114797422 AGTGAGAAGTACACAATTGAGGG - Intergenic
1031517418 7:122718392-122718414 GGAGAGAAGTAGAAAGAGGGAGG + Intronic
1031744655 7:125478765-125478787 AAAGAGAAGAAGAGAGATTAAGG + Intergenic
1031748064 7:125530486-125530508 GGAGAGAAGAGGACAGAAGAAGG + Intergenic
1032090047 7:128907051-128907073 GGAGAGAGGCAGACAGGTGAGGG + Intronic
1032369834 7:131337359-131337381 AGAGAGCAGGAGACATATGGGGG - Intronic
1032473993 7:132199961-132199983 AGAGGGAGGTGGACAGATGTGGG + Intronic
1032650824 7:133876508-133876530 AGAAAGAAGAAGAAAAATGAAGG - Intronic
1032906193 7:136369970-136369992 AGTGAGAAGCAGTCACATGATGG + Intergenic
1033528951 7:142244232-142244254 AGAGAGAAACAGAGAGAAGAGGG - Intergenic
1033621311 7:143064207-143064229 CTAGAGAAGGAGACAGACGAGGG - Intergenic
1033666591 7:143446452-143446474 GGGAAGAAGGAGACAGATGATGG - Intergenic
1033853610 7:145528497-145528519 AGAGAGAAAAATACAGAAGAAGG + Intergenic
1034183421 7:149156160-149156182 GGAGAGAAGTGGACAGATGCAGG + Intronic
1035404847 7:158590044-158590066 AGAGAGAAGGAGAGAGAGGGAGG - Intergenic
1035889586 8:3329090-3329112 AGAGAGAAGATGCCAGATGTTGG + Intronic
1036192271 8:6680865-6680887 AGAGAGAAGGAGGGAGAGGAAGG - Intergenic
1036593501 8:10191235-10191257 AGACAGAAGTAAAAAGATGGTGG - Intronic
1037315890 8:17599111-17599133 AGAGAGAAGTAAAGACATAAAGG - Intronic
1037462948 8:19131504-19131526 AGAGAGGAGTAGAGGGAGGAAGG + Intergenic
1037605623 8:20435153-20435175 AGACAGAAGTAGAGAGTTAAGGG - Intergenic
1037753406 8:21696922-21696944 AGAGGGAAGGGGACAGAGGAAGG + Intronic
1038346550 8:26737491-26737513 AGAAGGAAGTAGACAGAAAATGG - Intergenic
1038734226 8:30154925-30154947 AGAGAGAAGTAGGCAGGGGCTGG + Intronic
1038951537 8:32420516-32420538 AGAGAGAGAGAGAGAGATGAGGG - Intronic
1039258797 8:35748480-35748502 AGAGAGAAGTATGTAGAGGAGGG - Intronic
1039381081 8:37086053-37086075 TGAGAAAAATAGACACATGAGGG - Intergenic
1039390855 8:37179866-37179888 AGAGAGAAGAAGAAAGAAGAGGG - Intergenic
1040033924 8:42850627-42850649 AGTGAGAAGCAGACAGACAATGG + Intronic
1041234764 8:55788917-55788939 AGAAAAAAGCAGGCAGATGAGGG - Intronic
1041404069 8:57478113-57478135 AGTGAGAAATAGAGATATGAAGG - Intergenic
1042633323 8:70844681-70844703 TGGGAGAAGTACACAGATGACGG - Intergenic
1042795447 8:72657957-72657979 ATGGAGAAGGAGACAGATGGAGG - Intronic
1042915470 8:73871085-73871107 AGAGATAAGTAAACGGATGAGGG + Intronic
1043185084 8:77138182-77138204 TGAAAGAAGAAGACAGAGGAAGG - Intergenic
1043834524 8:85031951-85031973 AGAGAGAAGGAGAGAGATAGTGG + Intergenic
1044456241 8:92395488-92395510 AGAGAGAAAGAGACAGAAAAAGG - Intergenic
1045046167 8:98281151-98281173 AGAGAGAAGAGGAGAGATGTAGG + Intronic
1046509897 8:115188966-115188988 AGAGAGAATCAGAAGGATGAAGG - Intergenic
1047248087 8:123161320-123161342 TGGGAGAAGGAGGCAGATGAAGG - Intergenic
1047319524 8:123766606-123766628 TGAGAAAAGCAGACACATGAAGG - Intergenic
1047363472 8:124190965-124190987 AGAGAGAAGAAGAAAAAAGAAGG + Intergenic
1047364098 8:124196406-124196428 AGAGAAAAGCAGATAGTTGAGGG - Intergenic
1047608506 8:126497824-126497846 AAAGAGAAATACTCAGATGAGGG + Intergenic
1047718966 8:127620911-127620933 AGAGCAAGGGAGACAGATGAGGG + Intergenic
1048141774 8:131801956-131801978 GGTGAGAAGGAGACAGGTGAGGG + Intergenic
1048546758 8:135394803-135394825 AGAGAGCAGCAGACAGAACAAGG + Intergenic
1050632127 9:7571274-7571296 AGAGAGAAAGAGAATGATGATGG + Intergenic
1050667537 9:7958058-7958080 TGAGAAAAACAGACAGATGAAGG - Intergenic
1050712397 9:8480404-8480426 AGAGAAAATTAGATAGATAAGGG - Intronic
1050985937 9:12082310-12082332 AGAGAGAAGTGGAAGGAGGAAGG + Intergenic
1051567404 9:18516253-18516275 AGAGAGATGGAGACAGATACTGG + Intronic
1051693869 9:19747212-19747234 AGAGAGAAGTGGAATGAAGAGGG - Intronic
1051804522 9:20977169-20977191 ACAGAGAACCAGAAAGATGATGG - Intronic
1051888102 9:21916037-21916059 AGAGAGAAGGAGAGAGAGGGAGG + Intronic
1051951459 9:22638948-22638970 ATAAAGAAGTTAACAGATGATGG + Intergenic
1051974806 9:22936423-22936445 AGAGAAAAGAAGACAGAAGAAGG - Intergenic
1052422354 9:28259562-28259584 ACAGGGAAGAAGAGAGATGAAGG + Intronic
1052430116 9:28355218-28355240 AGAGAGATAGAGACAGATTACGG - Intronic
1052685420 9:31749335-31749357 AGGGAGAAATAGAGAGATGTTGG + Intergenic
1053179506 9:35956408-35956430 AGATAGAAGTAGACAGATGGTGG - Intergenic
1053308222 9:36999160-36999182 GGAGAGAGGTAGAGAGATGTGGG - Intronic
1053475916 9:38382017-38382039 AGGTAGAAGCAGACAGATCAGGG - Intergenic
1054149543 9:61590146-61590168 AGAGAAAAAAAGAAAGATGAAGG + Intergenic
1054361094 9:64120623-64120645 AGACAAAAGTAGATAGATGGTGG - Intergenic
1054469303 9:65521249-65521271 AGAGAAAAAAAGAAAGATGAAGG + Intergenic
1055510086 9:76987516-76987538 AGAGAGAAAGAGAGAGTTGAGGG + Intergenic
1056041345 9:82670476-82670498 AGAGAGAAAGAGACAGAGGAAGG + Intergenic
1056277713 9:85009337-85009359 AGAAAGAAGTAAACAGTTGAGGG - Intronic
1057722704 9:97545731-97545753 AGAGAGAAGAAGCCAAAAGAGGG - Intronic
1057944578 9:99314175-99314197 AGAGAGAAAGAGAGAGAGGAGGG - Intergenic
1057961552 9:99462272-99462294 ACAGAGAAGCAGATAGAAGAGGG - Intergenic
1058204562 9:102087123-102087145 GCAGAGATGAAGACAGATGATGG - Intergenic
1058661867 9:107274041-107274063 AGAAAGAAGGAGACAGAAGGAGG + Intergenic
1058985830 9:110207728-110207750 AGGGGGAAGGAGAAAGATGAAGG + Exonic
1058987907 9:110225797-110225819 AGAGAGAAGGAGAGTGAGGAGGG - Intergenic
1058994952 9:110290629-110290651 AGTGAGAAGCAGACAGAAGTGGG - Intergenic
1059162699 9:112050414-112050436 GGAGAGAAGCAGACAAATGGAGG + Intronic
1059366363 9:113789539-113789561 AGAGAGAAGAAGAAGGAGGAGGG - Intergenic
1059369906 9:113820851-113820873 AGAGAGAAATAGATTGACGATGG + Intergenic
1059409726 9:114124365-114124387 AGAGAGGAGGAGGCAGAGGAGGG + Intergenic
1059614832 9:115938218-115938240 AAATAGAAGAAGAAAGATGATGG + Intergenic
1060530364 9:124344139-124344161 AGAGAGAAGGGCACAGAAGAGGG - Intronic
1060544455 9:124452065-124452087 GGAGAGAAGAAGACAGGTGGGGG - Intronic
1060681240 9:125567131-125567153 TGAGAGAAGTGGACAGATTCTGG - Intronic
1060830896 9:126715574-126715596 AGAGAGAGGCAGAGAGAGGAAGG + Intergenic
1061026823 9:128055290-128055312 AGAGAGAGGGAGAGAGAGGAAGG + Intergenic
1061670258 9:132184542-132184564 GGAGAGCTGTAGACAGAAGATGG + Intronic
1061841396 9:133360363-133360385 AGAGAGAAGGCCACTGATGAGGG + Exonic
1203693501 Un_GL000214v1:68841-68863 AGACAAAAGTAGATAGATGGTGG + Intergenic
1203706051 Un_KI270742v1:48684-48706 AGACAAAAGTAGATAGATGGTGG - Intergenic
1203557951 Un_KI270744v1:17208-17230 AGACAAAAGTAGATAGATGGTGG + Intergenic
1203642772 Un_KI270751v1:35222-35244 AGACAAAAGTAGATAGATGGTGG - Intergenic
1185513673 X:682028-682050 AGGGAGAAGGAGACAGAAAAAGG + Intergenic
1185524970 X:770840-770862 ATAGATAGATAGACAGATGATGG - Intergenic
1185524978 X:771144-771166 ATAGACAAATAGATAGATGATGG - Intergenic
1185545470 X:940593-940615 AGAGAGAGATAGAGAGAGGAAGG - Intergenic
1185567449 X:1106458-1106480 AGAGAGAAGGAGACAGAGAGAGG + Intergenic
1185659604 X:1716499-1716521 AGACAGAGATACACAGATGATGG - Intergenic
1185683974 X:1911695-1911717 AGAGAGAGGAAGAGAGAGGAGGG - Intergenic
1185695855 X:2194007-2194029 ATAGGTAGGTAGACAGATGATGG - Intergenic
1185701260 X:2232133-2232155 AGAGAGGAGGAGAAAGAGGAAGG - Intronic
1185714435 X:2330053-2330075 AGAGAGAAGCAGAGAGACGGCGG + Intronic
1185725578 X:2418964-2418986 AGGGAGATGTAAACAGATCATGG + Intronic
1185807709 X:3075706-3075728 AGAGACAAGCAGACAGAGAAAGG - Intronic
1185942204 X:4334191-4334213 TGAGAGAAATAGGCAGATGTTGG + Intergenic
1186363026 X:8862580-8862602 AGAGAGAAGAGGAGAGAAGAAGG + Intergenic
1186437141 X:9552314-9552336 ACAGAGAAATAGACTGATGGTGG - Intronic
1187272482 X:17791740-17791762 AGAGAGAAAGAGAGAGAGGAAGG + Intergenic
1187319577 X:18227696-18227718 AGAGAGAAAAAGAGAGAGGAGGG + Intergenic
1188548093 X:31332420-31332442 AGAGAGGAGTAGAGAGAGAAGGG + Intronic
1188606689 X:32040323-32040345 AGAGAGAAGAAAAAATATGAAGG - Intronic
1188801648 X:34538974-34538996 AGAGGGAAGTAGAGAGAGGGAGG + Intergenic
1189214494 X:39311417-39311439 AGAGAGAAGAACACAGGGGACGG + Intergenic
1189483061 X:41407908-41407930 AGAGAGAAATAGAGATTTGAAGG - Intergenic
1189822278 X:44881586-44881608 ATACAGAAGTAAACAAATGATGG - Intronic
1190215915 X:48479247-48479269 AGGGAGAAGTTGCCAGATGTGGG - Intronic
1190439575 X:50463604-50463626 AGAGAGAAACAGAGAGAGGAAGG - Intronic
1190711707 X:53076444-53076466 AGAGAGAGACAGAGAGATGAGGG - Intronic
1190764346 X:53463734-53463756 AGAGAGAGAGAGACAGAGGAAGG - Intergenic
1191785572 X:64914083-64914105 AGAGAGAAGAAGGAAGAGGAGGG - Intergenic
1192204155 X:69085208-69085230 AGAGATGAGTAGAGAGAAGAAGG - Intergenic
1192475737 X:71440911-71440933 AGAAAGAAGGAGAAAGAAGAAGG - Intronic
1194119455 X:89942909-89942931 AGAGAGCAGTAGACAGCAGCAGG + Intergenic
1194860636 X:98994416-98994438 AGAGAGAGAGAGAGAGATGAGGG + Intergenic
1194969479 X:100327109-100327131 AGATAGAAGCAAACAGATGAGGG + Intronic
1195021656 X:100834226-100834248 AGAGAGAAGTACGCAGAGGAAGG - Intronic
1195517077 X:105789345-105789367 AGAGAGACAGAGACAGAGGAAGG + Intergenic
1195666701 X:107438043-107438065 AGAGAGAAGTGGATAGATTCTGG - Intergenic
1195732723 X:107982210-107982232 AGGGCGGAGAAGACAGATGAGGG - Intronic
1196024874 X:111031368-111031390 AGAGAAAAGGAAACAAATGAAGG + Intronic
1196212745 X:113013576-113013598 AGAGAGAGAGAGAGAGATGAGGG + Intergenic
1197037972 X:121900143-121900165 CAAGAAAAGTAGATAGATGATGG + Intergenic
1197146320 X:123176413-123176435 AGAGAAAAGGAGAGGGATGAGGG - Intergenic
1197521835 X:127508533-127508555 AGAGAGAAGCAGACAGAATATGG - Intergenic
1198063341 X:133070038-133070060 AGAGACAAGAGGAAAGATGAGGG + Intronic
1198818751 X:140622389-140622411 AAAAAGAAGAAGAAAGATGAAGG + Intergenic
1198893906 X:141429858-141429880 ATAGATAAGTAGCCAGATGAAGG + Intergenic
1198921974 X:141739150-141739172 AGAGAGTAGTACAGAGATTAGGG + Intergenic
1199109926 X:143919733-143919755 AGAGAGAAGGAGGAAGAAGAAGG + Intergenic
1199404769 X:147444072-147444094 AGACCGAAGTAGGCAGGTGAAGG - Intergenic
1199598883 X:149528751-149528773 AGAGAGAGGGAGAAAGAGGACGG - Intronic
1199757533 X:150879298-150879320 AGAGAGATGTTGAAGGATGAAGG + Intronic
1200472328 Y:3600466-3600488 AGAGAGCAGTAGACAGCAGCAGG + Intergenic
1201241502 Y:11961210-11961232 AGAGATCAATAGATAGATGAAGG - Intergenic
1202099129 Y:21287385-21287407 AGAAAAAAATAGAAAGATGAGGG + Intergenic
1202258286 Y:22942845-22942867 AGACAGAAAGAGAGAGATGAAGG + Intergenic
1202411276 Y:24576603-24576625 AGACAGAAAGAGAGAGATGAAGG + Intergenic
1202459505 Y:25093469-25093491 AGACAGAAAGAGAGAGATGAAGG - Intergenic