ID: 1150369623

View in Genome Browser
Species Human (GRCh38)
Location 17:64625713-64625735
Sequence CTAATTCAGTAGGTCTATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 558
Summary {0: 1, 1: 0, 2: 7, 3: 79, 4: 471}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150369616_1150369623 16 Left 1150369616 17:64625674-64625696 CCTGTTAAAATACACCGCTGAGT 0: 1
1: 0
2: 0
3: 6
4: 66
Right 1150369623 17:64625713-64625735 CTAATTCAGTAGGTCTATATGGG 0: 1
1: 0
2: 7
3: 79
4: 471
1150369615_1150369623 25 Left 1150369615 17:64625665-64625687 CCTAGAGGGCCTGTTAAAATACA 0: 1
1: 3
2: 48
3: 248
4: 794
Right 1150369623 17:64625713-64625735 CTAATTCAGTAGGTCTATATGGG 0: 1
1: 0
2: 7
3: 79
4: 471
1150369618_1150369623 -7 Left 1150369618 17:64625697-64625719 CCTAACTCCAGAGTTCCTAATTC 0: 1
1: 1
2: 12
3: 144
4: 638
Right 1150369623 17:64625713-64625735 CTAATTCAGTAGGTCTATATGGG 0: 1
1: 0
2: 7
3: 79
4: 471
1150369617_1150369623 2 Left 1150369617 17:64625688-64625710 CCGCTGAGTCCTAACTCCAGAGT 0: 1
1: 0
2: 0
3: 11
4: 145
Right 1150369623 17:64625713-64625735 CTAATTCAGTAGGTCTATATGGG 0: 1
1: 0
2: 7
3: 79
4: 471

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150369623 Original CRISPR CTAATTCAGTAGGTCTATAT GGG Intronic
902253392 1:15171135-15171157 CTGATTCAGTAGGTCTGAGTGGG + Intronic
903573518 1:24323307-24323329 CTGATTCAGTAGGTCTAGGGTGG - Intronic
903912176 1:26735670-26735692 CTCATTCAGTAGGTCTGGAGTGG + Intronic
904252046 1:29231903-29231925 CTAATTCAGTAGGTCTAAGATGG - Intergenic
904883555 1:33718648-33718670 CTGATTCAGTAGGTCTTCAGTGG - Intronic
904888912 1:33763374-33763396 CCAATTCAGTAGGTCCAAAATGG - Intronic
905275570 1:36815698-36815720 CTGACTCAGGAGGTCTAGATGGG - Intronic
905679413 1:39857012-39857034 CTAATTCAGTAGGTCTGGAGTGG + Intronic
906065475 1:42977475-42977497 CTAAGTCAGTAGGTCTCAAGTGG + Intergenic
906793812 1:48681000-48681022 CTAATTCAGTGGGTCTGGAGTGG - Intronic
906971157 1:50515470-50515492 CTGATTCAGTAGGTCTAGCTTGG + Intronic
908077885 1:60540999-60541021 CTAATTCAGTAGTTCTGGAGTGG + Intergenic
909426500 1:75531547-75531569 CTGATTCAGTAGGTCTAAGGTGG + Intronic
910474147 1:87589022-87589044 CTGATTCAGTAGGTCTGGGTTGG - Intergenic
910753234 1:90657287-90657309 CTGATTCGGTAGGTCTGGATGGG - Intergenic
911378213 1:97077537-97077559 CTAATTCAGTAGGTAAAGATGGG + Intergenic
911695075 1:100881756-100881778 TTAATTCATTAGTTCTTTATAGG + Intronic
912145533 1:106789601-106789623 CTGATTCAGTAGGTCTAGGACGG + Intergenic
912203948 1:107490067-107490089 CTGATTCAGTAGGTCTGAAATGG + Intergenic
912414086 1:109496413-109496435 ATAATTCAGTGGGTCAAAATGGG + Exonic
912843557 1:113060111-113060133 CTGATTCAGTAAGTCTAAAGTGG - Intergenic
913165010 1:116177153-116177175 CTGATTCAGTAGGTCCAGAGTGG - Intergenic
913365445 1:118032992-118033014 CTGATTCAGTAGGTCAAGGTGGG - Intronic
914046499 1:144097838-144097860 CTCATTCAGTAGGTCTGGAGTGG + Intergenic
914131611 1:144862848-144862870 CTCATTCAGTAGGTCTGGAGTGG - Intergenic
915019945 1:152769679-152769701 CTAATTCAGTGGTTCTCAATGGG - Intronic
916265299 1:162884603-162884625 CTAATTCAGTAGGTCTGGAGTGG + Intergenic
917634844 1:176925424-176925446 CTAATTCAGTAAGTCTGGGTGGG - Intronic
918582224 1:186144896-186144918 CTATTTCACTTGCTCTATATAGG + Intronic
919129450 1:193434919-193434941 CTAATTCAGTAGGTTTGGAGTGG + Intergenic
920765796 1:208832495-208832517 CTGATTCAGTAGGTCTCGAGTGG - Intergenic
923165607 1:231358732-231358754 ATAATTCAGTAGGTAAATATTGG + Intergenic
923397711 1:233583606-233583628 CTAATTCAGTTGGTCTATGGAGG - Intergenic
924093742 1:240529074-240529096 TTCATTCAGTAGGTCTATAAAGG + Intronic
924498342 1:244611962-244611984 CTAATTCAGCAGGTCTTGGTTGG + Intronic
924736614 1:246762920-246762942 CTGATTCAGTAGGTCTGGAGTGG + Intronic
1064312601 10:14224886-14224908 CTTATTAAGTAGGTCAATAACGG - Intronic
1065308838 10:24394961-24394983 CTGATTCAGTAGGTCTAGGGTGG + Intronic
1065623383 10:27606490-27606512 CCAATTCAGTAGGTCTGGAATGG + Intergenic
1065770886 10:29077334-29077356 CTAATTCAGCAAGTATTTATTGG - Intergenic
1065832675 10:29629439-29629461 CTGATTCAGTAGGTCTGCACTGG - Intronic
1066989000 10:42494742-42494764 CAAATGCAGTAGGTCCGTATGGG - Intergenic
1067853948 10:49775222-49775244 CTGATTCAGTAGGTCTAGGGTGG - Intergenic
1068027112 10:51659943-51659965 CTGATTCAGTAGGTCTAGAGTGG - Intronic
1068482916 10:57617184-57617206 CTAATTTAGTAAGTCTGTGTGGG - Intergenic
1068928907 10:62568536-62568558 CTGATTCAGTAGGTCTGGAGTGG - Intronic
1069331609 10:67300070-67300092 CTAATTCAATAGGTCTGAAGTGG - Intronic
1069783354 10:70970686-70970708 CTAGTTCTGTAGGTATTTATGGG - Intergenic
1070417706 10:76205932-76205954 CTAATTCAGTAGGTCTGGGATGG - Intronic
1070481588 10:76888210-76888232 CCAATTCAGTAGGTCTGGGTGGG - Intronic
1071331341 10:84564129-84564151 CTGATTCAGTAGGTCTGGGTGGG - Intergenic
1071675554 10:87652460-87652482 CTCATTCAGAAGGTCTAGAGTGG - Intergenic
1071696039 10:87872662-87872684 CTGATTCAGTAGGTCTGGATTGG + Intronic
1071726532 10:88203603-88203625 CTGATTCAGTAGGTCCAGAATGG - Intergenic
1071795182 10:88997220-88997242 CTGATTCCTTAGGTCTATGTAGG + Intronic
1073434224 10:103506487-103506509 CCAATTCAGTCGGTCCTTATTGG + Intronic
1074225908 10:111484076-111484098 CTAAGTCAGTAGTTCTAGAGAGG - Intergenic
1074920310 10:118001913-118001935 CTGATTCAGTAGGTCTGGGTAGG + Intergenic
1074993612 10:118735455-118735477 CTGATTCAGCAGGTCTGTGTTGG - Intronic
1075262096 10:120971912-120971934 CTAATTCAGTAGGGATGGATAGG - Intergenic
1076341237 10:129746622-129746644 GTGCTTCAGTAGGTCTATTTTGG + Intronic
1078732197 11:13985058-13985080 CTGATTCAGTAAGTCTGGATGGG - Intronic
1078923494 11:15853255-15853277 CTGATTCAGTAGGTCTCAAGTGG + Intergenic
1079603096 11:22334875-22334897 CTGATTCAATAGGTCTAGAGTGG - Intergenic
1080089297 11:28325693-28325715 CTAATTCAGTAGATCTGGAGTGG + Intronic
1080637339 11:34135499-34135521 CTGATTCAGTAGGTCTGGAGTGG - Intronic
1080757573 11:35216836-35216858 CTGATTCAGTAGGTCTGGGTTGG - Intronic
1080914093 11:36637605-36637627 CTAATTCAGAAGGTCTTTGGTGG + Intronic
1081663062 11:44900190-44900212 CACATTCAGTAGGCCTCTATAGG + Intronic
1082715792 11:56611807-56611829 CTAATTCAGTAGGAGTCAATAGG - Intergenic
1083485030 11:62977849-62977871 CTAATCCAATAGGTGTATGTTGG - Intronic
1083903550 11:65655582-65655604 CTGATTCAGTAGGTCTGTAATGG + Intronic
1085667589 11:78428823-78428845 CTGATTCAGTAGGTCTGTGATGG - Intergenic
1085912056 11:80838865-80838887 CTAATTCAGTAGGTCTGAGGTGG - Intergenic
1086344725 11:85884389-85884411 CTGATTCAGTAGGTCTGGGTGGG - Intronic
1086446509 11:86876623-86876645 CTGATTCAGTAGGTCTGTGGTGG - Intronic
1086567872 11:88247271-88247293 CTAATTCAATAGGTCTGGAATGG + Intergenic
1087961163 11:104351364-104351386 GTAATTCAGTAAATATATATTGG - Intergenic
1088036389 11:105321465-105321487 TTGATTCAGTAGGTCTAGTTTGG + Intergenic
1088630554 11:111770216-111770238 CTAATTCAGTAGGTCTGGGTTGG - Intergenic
1088854977 11:113740746-113740768 CTGATTCAGTAGGTCTGGAATGG - Intronic
1089219615 11:116859802-116859824 CTGATTCAGTAGGTCAGGATGGG + Intronic
1089412733 11:118260453-118260475 CTAATTCAGTAGGTCTGGGGTGG - Intronic
1089568414 11:119385541-119385563 CTGATTCAGTAGGTCTAGGATGG + Intergenic
1090244245 11:125204346-125204368 CTGATTCAGCAGGTCTGTGTGGG + Intronic
1090298013 11:125607578-125607600 CTGATTCAGTAGGTCTGTGTTGG - Intronic
1093144766 12:15552393-15552415 ATAATTCAGCAGGTTAATATTGG - Intronic
1093387425 12:18575290-18575312 CTGATTTAGTAGCTCTAGATAGG - Intronic
1093956316 12:25223021-25223043 CTAATTCAGAAGGTTTAGGTGGG - Intronic
1094352027 12:29537613-29537635 CAGATTCAGTAGGTCTGGATGGG - Intronic
1095312360 12:40715185-40715207 CTAATTCATTAGGTCTGGAGTGG + Intronic
1096855492 12:54478890-54478912 CTGATTCAGTTGGTCTGTAATGG - Intergenic
1097111113 12:56658885-56658907 CTGATTTAGTAGGTCTATTTGGG + Intergenic
1098843665 12:75509303-75509325 CTCATTCAGTAGGTCTGTAGTGG - Intronic
1099278776 12:80615008-80615030 TTGATTCAGTAGGTCAATACAGG - Intronic
1100425593 12:94482609-94482631 CTGATTTAGTAGGTCTACAGTGG + Intergenic
1100973903 12:100100785-100100807 CTGATTCAGTAGGTCTGGAATGG - Intronic
1101290495 12:103362532-103362554 ATAATTCAGTAGGTCAATTAAGG + Intronic
1101915334 12:108891544-108891566 CTAATTCAGCAGGTATAGAGTGG - Intronic
1102998812 12:117369662-117369684 CTGATTCACTAGGTCTAGAGTGG - Intronic
1104004905 12:124885045-124885067 CTGATTCAGTAGGTCTGGGTGGG + Intergenic
1104793797 12:131501695-131501717 CTCATTCATCAGGTCTATTTTGG - Intergenic
1106779593 13:33044387-33044409 TTGATTCAGTAGGTCAATCTGGG + Intronic
1107277358 13:38691479-38691501 TTAATTCAGTATGTCCATTTGGG + Exonic
1107280001 13:38722613-38722635 CTAATTCAGTAGGTCTGGATGGG + Intronic
1107473694 13:40714564-40714586 CTACTTCAGTAGGGCTATTTGGG - Intergenic
1107491534 13:40884309-40884331 CTACTTCAGTAGGGCTATTTGGG - Intergenic
1107594832 13:41952160-41952182 CTAATTCAGTAGGTCTGAGGTGG - Intronic
1108439934 13:50441186-50441208 CTAATTCAGTTGGTCTGAAATGG - Intronic
1108705025 13:52977569-52977591 CTGATTCAGTGGGTCTGGATGGG - Intergenic
1109059198 13:57591741-57591763 CAACTTCAGCAGGTATATATCGG + Intergenic
1110098390 13:71561687-71561709 CTAATACACTAGGTCTAAAATGG + Intronic
1110237194 13:73229213-73229235 CTAATGCAGTAGCTCTCTTTTGG + Intergenic
1110278962 13:73670556-73670578 CTGATTCAGTAGGTCTAGGGTGG - Intergenic
1110494311 13:76148615-76148637 CTGATTCAGTATGTCTACACAGG + Intergenic
1111147404 13:84202234-84202256 CTAATTCAATAGGTAAATGTAGG + Intergenic
1111738803 13:92176163-92176185 CTAATTCAGTAAGTCTAGGATGG + Intronic
1111793482 13:92888130-92888152 CTAATTCAGTCGGTCTAGGGTGG + Intergenic
1111804948 13:93029367-93029389 CTAATTCAGTAGGTCTGGGGTGG + Intergenic
1111888668 13:94054432-94054454 CTAATTCAGTAGGTCTGGGGTGG + Intronic
1111918450 13:94385705-94385727 TTAATTCAGCAAGTCTTTATTGG - Intronic
1111958042 13:94779681-94779703 CTGATTCAGTAGGTCTAGGGTGG + Intergenic
1112029211 13:95441672-95441694 CTGATTCAATAGGTCTGTAGTGG - Intronic
1112185361 13:97123372-97123394 CTGATTCAGTAGGTCTAGATGGG + Intergenic
1112259895 13:97868491-97868513 CTGATTCAGTAGATCTAGACAGG + Intergenic
1112760281 13:102687678-102687700 CTCATTCAGTAGGTCGAGAGTGG + Intronic
1113125891 13:106979145-106979167 CTGATTCAGTAGGTCTGGCTGGG + Intergenic
1113636805 13:111925064-111925086 CTGATTCAGGAGGTCTAGGTGGG + Intergenic
1114774758 14:25468920-25468942 CTAATACAGTAGGTCTGGGTAGG - Intergenic
1114913120 14:27225654-27225676 CTTATTCAGTAAGTCTAGGTGGG + Intergenic
1115424610 14:33243466-33243488 CTGATTCAGTAAGTCTATGGTGG + Intronic
1115449913 14:33535584-33535606 TTAATTCATTAGGTATTTATTGG - Intronic
1115537140 14:34383957-34383979 CTGATTCAGTAGGTCTGGGTTGG - Intronic
1117045773 14:51811643-51811665 CTGATTCAGTAGGTCTAGGGTGG + Intergenic
1117440537 14:55755126-55755148 CTGATTCAGTAGGTCTGGAATGG - Intergenic
1117668465 14:58081276-58081298 CTGATTCAGTAGGTCTGGGTGGG - Intronic
1118055972 14:62080253-62080275 CTGATTCAGTAGGTCTGGAGTGG - Intronic
1118135086 14:63015275-63015297 CTAATTCAGTAGGTTTAAGCGGG + Intronic
1118357182 14:65024132-65024154 CTAATTCAGTAGAACTAGATGGG - Intronic
1118823524 14:69360726-69360748 CTGATTCAGTAGGTCTGAGTGGG - Intergenic
1119615597 14:76096744-76096766 CTAATTCAGTAGGTTCGTCTGGG + Intergenic
1119701130 14:76755592-76755614 CTCATTCAGCAGGTCCATGTGGG - Intergenic
1119952001 14:78754712-78754734 CTGGTTCAGTAGGTCTAGAGTGG - Intronic
1121922939 14:97899958-97899980 CTAATTCAGTAGGTCTGAGATGG + Intergenic
1124544937 15:30618147-30618169 CTGATTCAGTAGGTCTAGGGTGG + Intergenic
1124778459 15:32607552-32607574 CTGATTCAGTAGGTCTAGGGTGG + Intergenic
1125431907 15:39603912-39603934 CTGATTCAGTAGGTCTGCAGTGG + Intronic
1125664673 15:41420826-41420848 CTGATTCAGTAGGTCTAGGATGG - Intronic
1125990202 15:44099292-44099314 CTGATTCAGTAGGTCTAGAGTGG + Intronic
1126168349 15:45672956-45672978 CTGATTCAGTAGGTCTAGGGTGG + Intronic
1126574832 15:50186285-50186307 CTGATTCAGTAAGACTATGTTGG + Intronic
1126632916 15:50755687-50755709 CTGATTCAGTAGGTCTGGAATGG - Intronic
1126874994 15:53032023-53032045 CTGATTCAGTAGGTCTGGAGTGG - Intergenic
1127064128 15:55219536-55219558 CTGATTCAGTAGGTCTGGGTTGG - Intronic
1127158699 15:56156933-56156955 CTGATTCAGTAGGTCTCAAGTGG + Intronic
1127161415 15:56190677-56190699 CTGATTCAGTAGGTCTGTAGTGG - Intronic
1127592568 15:60440620-60440642 CTGATTCACTAGGTCTGTATTGG - Intronic
1127800967 15:62477221-62477243 CTAACTCAGTAGGTCTGGGTGGG + Intronic
1127823307 15:62679976-62679998 CTAGTTCAGCACATCTATATGGG + Intronic
1128186748 15:65649068-65649090 CTAATTCAGTTGGTCCAGGTGGG + Intronic
1128557923 15:68644328-68644350 TGGATTCAGTAGGTCTAGATTGG + Intronic
1128633466 15:69287854-69287876 CTGATTCAGTAGGTCTGGGTTGG - Intergenic
1128724724 15:69979960-69979982 CAAATTCAGTAGGTCTGGGTGGG - Intergenic
1128849506 15:70938769-70938791 CTAATTCAGTAGTTTTAGGTAGG + Intronic
1128992099 15:72269582-72269604 CTAATTCAGTAGGTCTTAGGAGG - Intronic
1129115325 15:73362454-73362476 CTGATTCAGTAGGTCTGGATGGG - Intronic
1129486998 15:75883671-75883693 CTGATTCAGTAGGTCTGTGGTGG + Intronic
1130606998 15:85326742-85326764 CTAATTCAGTAGGTCTGAGTGGG + Intergenic
1130742302 15:86613791-86613813 CTAATTCAGTAGGTCTGGGATGG - Intronic
1130959156 15:88648349-88648371 TCAATTCAGTAGGTCTGTGTAGG + Intronic
1133491056 16:6268482-6268504 CTGATTCAGGAGGTCTATGCTGG - Intronic
1133726827 16:8545612-8545634 CTAATTCAGTAGATCATTAGTGG + Intergenic
1133900556 16:9969935-9969957 CTAATTCAGTAGGTCTAAGATGG - Intronic
1134346924 16:13399775-13399797 CTGATTCAGTAGGTCTGGAGTGG + Intergenic
1134751716 16:16630545-16630567 ATAATTCAGTAAGAATATATTGG + Intergenic
1134993742 16:18723078-18723100 ATAATTCAGTAAGAATATATTGG - Intergenic
1135237206 16:20768415-20768437 CCAATTCAGTAGATCTAGAGTGG + Intronic
1135378603 16:21973252-21973274 CTGAGTCAGTAGGTCCATTTTGG + Intronic
1135490070 16:22901417-22901439 CTGATTCAGTAGGTCTAGGGAGG - Intronic
1136040014 16:27571469-27571491 ATAAGTCATTAGGTCTCTATGGG - Intronic
1138038149 16:53629381-53629403 CTAATTCATTAGGTCTCTGGTGG + Intronic
1138053566 16:53808759-53808781 CTTATTGAGTGGGACTATATCGG + Intronic
1138559704 16:57793850-57793872 TTAATTAAGTGGTTCTATATAGG + Intronic
1138736215 16:59252881-59252903 CTGATTCAGTAGGTCTGGAATGG - Intergenic
1138938693 16:61762604-61762626 CTAATTCAGTAGGTCTTGTTTGG - Intronic
1139005572 16:62567461-62567483 CTAATTCAGTAGGTCTGGGGTGG + Intergenic
1139184529 16:64790166-64790188 CTGATTCAGTAGGTCTGAATTGG + Intergenic
1140061580 16:71574844-71574866 CTAATTTAATAGGTATAGATGGG + Intronic
1140429529 16:74889969-74889991 CTGATTCAGTAGGTCTAAGTGGG - Intronic
1140841172 16:78840662-78840684 CTGATTCAGTAGGTCTAGGTGGG + Intronic
1141408915 16:83818977-83818999 CTGATTCAGTAGGGCTAGGTAGG - Exonic
1141737113 16:85861121-85861143 CTAATTCAGTAGTTCTCAACAGG + Intergenic
1146801827 17:35830801-35830823 CTTATTCAGTAGGTCTAGGGTGG + Intronic
1147233831 17:39041579-39041601 CTGATTCAGTTGGTCTAGAGTGG + Intergenic
1147533410 17:41301350-41301372 CTAAGTCAGTGGGTCTGCATTGG - Intergenic
1148173184 17:45541032-45541054 CTGATTCAGTTGGTCTAGAGTGG - Intergenic
1148276083 17:46304419-46304441 CTGATTCAGTTGGTCTAGAGTGG + Intronic
1148298201 17:46521995-46522017 CTGATTCAGTTGGTCTAGAGTGG + Intronic
1148362741 17:47026465-47026487 CTGATTCAGTTGGTCTAGAGTGG + Intronic
1148459387 17:47829945-47829967 CTGATTCAGTAGGTCTAGGCAGG - Intronic
1150369623 17:64625713-64625735 CTAATTCAGTAGGTCTATATGGG + Intronic
1150404390 17:64887949-64887971 CTGATTCAGTTGGTCTAGAGTGG - Intronic
1150569312 17:66372157-66372179 CTGACTCAGGAGGTCTAGATGGG + Intronic
1151245460 17:72791084-72791106 CTAATTTAGTAGGTCTGAAATGG - Intronic
1151883897 17:76912095-76912117 CTAATCCAATAGGTCCTTATAGG - Intronic
1153587843 18:6641902-6641924 CCAGTTCAGTAGGTATATAATGG + Intergenic
1155237901 18:23840030-23840052 CCAACTCAGTAGGTCTGTAGTGG - Intronic
1155814564 18:30289175-30289197 CTAATTCAGTAGGTCAGTAGGGG - Intergenic
1155911478 18:31508919-31508941 CTGACTCAGTAGGTCTGGATGGG - Intronic
1156130693 18:33970032-33970054 CCCATTCAGTAGGTCTACAGTGG + Intronic
1156867050 18:41900428-41900450 CTCATTCAGTAGATCTTTACTGG - Intergenic
1157004311 18:43563529-43563551 CTAAGTCAGTCTGTATATATAGG + Intergenic
1157009333 18:43627688-43627710 CCAATTCAGTAGCTCTATGGTGG - Intergenic
1157192240 18:45591290-45591312 CTCATTCAGTAGGTCTGTGGAGG + Intronic
1158700339 18:59739802-59739824 TTAATTCAATAGGCCTCTATGGG - Intergenic
1158982750 18:62780644-62780666 CTGATTCAGTAGGTCTGGAGTGG + Intronic
1164947106 19:32305150-32305172 CTAATTCAGTAGATCTGGAGTGG - Intergenic
1165931269 19:39360842-39360864 CTGATTTAGTAGGTCTATGGGGG - Intronic
1167584017 19:50362935-50362957 CTAATTAAGTAGGTCTAGGATGG + Intronic
1167844156 19:52146813-52146835 CTAATCCAGGAGGTGCATATGGG + Intergenic
1168035469 19:53715928-53715950 CTAATTCAGCAGGTTTAGGTGGG - Intergenic
1168039303 19:53745409-53745431 CTAATTCAGCAGGTTTAGGTGGG - Intergenic
1168039971 19:53750542-53750564 CTAATTCAGTAGGCTTAGGTCGG - Intergenic
1202686053 1_KI270712v1_random:51253-51275 CTCATTCAGTAGGTCTGGAGTGG + Intergenic
926346904 2:11955297-11955319 CCAATTCAGTAGGTCTAGCTTGG + Intergenic
926579550 2:14619640-14619662 CTGATTCAGTAGGTCTGGAATGG + Intergenic
928961459 2:36930541-36930563 CTCATTCAGTAGGTCTGGAGTGG + Intronic
929155341 2:38783939-38783961 CTGATTCAGTAGTTCTAGTTGGG + Exonic
929190980 2:39139364-39139386 CTAATTCAGCAGGTCTGAAGTGG - Intergenic
929198377 2:39209560-39209582 CTGATTCAGCAGGTCTGTAGTGG + Intronic
929757065 2:44775928-44775950 CAAATACAGTAGCTGTATATTGG + Intergenic
929837567 2:45420221-45420243 CTGATTCAGTAGGTCTAGGGTGG + Intronic
930926422 2:56823467-56823489 CTGATTCAGTAGGTCTAGGATGG + Intergenic
931045846 2:58352149-58352171 CCAATTCAGAAGGTCTAGTTAGG + Intergenic
932181258 2:69648384-69648406 CTTACTCAGTAGGTCTGGATGGG - Intronic
933645401 2:84808994-84809016 CTAACTCAGTAGGTCTTGAGTGG - Intronic
933845073 2:86319209-86319231 CTCATTCAGTAGGTCTGGAGGGG + Intronic
934245668 2:90303563-90303585 CTCATTCAGTAGGTCTGGAGTGG - Intergenic
934263078 2:91493473-91493495 CTCATTCAGTAGGTCTGGAGTGG + Intergenic
934972010 2:98771355-98771377 CTGATTCAGTAGGTCTGGAGAGG - Intergenic
935006152 2:99079484-99079506 CTGATTCAGTAGGTCTGGAGTGG - Intronic
935027248 2:99289067-99289089 CTGATTCAGTAGGTCTGAAATGG - Intronic
935119564 2:100171910-100171932 TTGATTCAGTAAGTTTATATGGG + Intergenic
935633990 2:105235834-105235856 CTAATTCAGTGGGTCTGGAGTGG + Intergenic
936328353 2:111524834-111524856 CTAATTCAGTAGGTCTGGGTTGG + Intergenic
936490185 2:112963411-112963433 CTGATTCAGTAGGTCTGGAGTGG + Intergenic
937160608 2:119758116-119758138 CTAATCCATTAGGTCTAGAGTGG - Intergenic
937209806 2:120261027-120261049 CTGATTCAGTAGGTCTGGAGTGG - Intronic
938698330 2:133854546-133854568 CTGATTCAGTAGGTCTGGAGTGG - Intergenic
940233074 2:151479041-151479063 CTGATTCAGTAGATCTGCATTGG + Exonic
940687410 2:156870645-156870667 CTTATTCAGTAGGTCTGTGGTGG + Intergenic
940748333 2:157596078-157596100 GTAATTCAGTACATCTTTATTGG - Intronic
941555414 2:166973674-166973696 CTAATTCAGTAGGTTAAGGTGGG - Intronic
941594462 2:167457837-167457859 CTAATTCGGTCGGTCTAGAATGG - Intergenic
941656486 2:168150039-168150061 CTGATTCAGTAGGTCTAGAGTGG - Intronic
942919479 2:181354121-181354143 CTAATTCAGTAGGTCTTGGGTGG + Intergenic
943162073 2:184267560-184267582 CTAATTTAGTAGGTCTGGAGTGG + Intergenic
943178576 2:184511160-184511182 ATTATTCAGTAGTTCTTTATAGG - Intergenic
944801002 2:203238196-203238218 TTGATTCAGTAGGTCTAGTTTGG + Intergenic
946715198 2:222546980-222547002 CTAATTCAGTAGGTCTGGGAGGG - Intronic
946792163 2:223312158-223312180 CAAAGTCAGTAAGTCGATATAGG + Intergenic
946891631 2:224282949-224282971 CTAATCCAGTAGGTCTGTGGTGG + Intergenic
946976009 2:225152236-225152258 CTAATTCTGTATAGCTATATAGG - Intergenic
946980639 2:225210754-225210776 CTGATTTAGTAGGTCTTGATGGG - Intergenic
947101784 2:226628844-226628866 CTAATTCAATAGGTCTGTGGTGG - Intergenic
1168984799 20:2038963-2038985 CTAATTCAGTGGGGCTGGATGGG - Intergenic
1169033172 20:2429166-2429188 TTAGTTCAGTAGGTCATTATTGG - Intronic
1169578939 20:6997077-6997099 CTGATTCAGTAGATCTAGAGTGG - Intergenic
1169692098 20:8343371-8343393 CTAATTGAGTAGGTCTAGGATGG + Intronic
1169868889 20:10230547-10230569 CAGATTCAGTAGGTCTGTGTGGG - Intronic
1169873366 20:10270739-10270761 CTAATTCAGTTGGTCTGAAATGG - Intronic
1170468663 20:16646436-16646458 CTGATTCAGTAGGTCTAGGGTGG + Intergenic
1170493032 20:16897943-16897965 CTGATTCAGGAGGTCTGGATGGG - Intergenic
1170777653 20:19391555-19391577 CTGATTCAGGAAGTCTAGATGGG - Intronic
1170818409 20:19734856-19734878 CTAGTTCAGGAGGTCTGGATGGG - Intergenic
1171943994 20:31359735-31359757 CTGATTCAGTAGATCTGTAATGG - Intergenic
1172595033 20:36145093-36145115 CTGACTCAGTAGGTCTGTGTGGG + Intronic
1173030774 20:39357520-39357542 CTGATTCAGTAGGTTGAGATGGG + Intergenic
1173279090 20:41611587-41611609 CTATTTCAGTAGGTCTGGAATGG + Intronic
1173770253 20:45650112-45650134 CTAATCCTGTAGCTCTATACTGG - Intronic
1174339260 20:49885926-49885948 CTAATTCAGTAGGTCTGAATGGG - Intronic
1174729068 20:52896736-52896758 CTAATACAGTAGGTACATAGAGG - Intergenic
1177719739 21:24890516-24890538 CTGATTCAATGGGTCTATAAGGG + Intergenic
1178056499 21:28804994-28805016 CTGATTCAGTTGGGCTAGATTGG + Intergenic
1178058419 21:28825267-28825289 CTGATTCAGTAGGTCTGGAGAGG + Intergenic
1178688870 21:34734075-34734097 CTGACTCAGTAGGTCTGGATGGG - Intergenic
1180191402 21:46165728-46165750 CTAAGTCAGAAGGTTTCTATAGG - Intronic
1181612489 22:24026949-24026971 CTAAATCTGTAGGTCTGTTTGGG + Intronic
1182972724 22:34592994-34593016 CTAATTCAATAGATATTTATTGG + Intergenic
1183142780 22:35959580-35959602 CTGATTCAGTAGGTCTACAGTGG + Intronic
949606708 3:5661525-5661547 CTAATTAAGTAGGTCTTGAGTGG - Intergenic
949704146 3:6796591-6796613 ATAATTCAATAGGTTTATATTGG + Intronic
949823215 3:8137756-8137778 CTCATTCAGTAGATATTTATGGG - Intergenic
950021483 3:9791045-9791067 CTAATTCAGTAAGCTTTTATTGG - Intronic
950763950 3:15259448-15259470 CTAATTCAGTCGGTCTAGAGTGG + Intronic
951597058 3:24329879-24329901 CTGATTCAGTAGGTCTGGAGTGG - Intronic
951642117 3:24847769-24847791 CTAATTCAGTACTTCTAGGTTGG + Intergenic
952188397 3:30996092-30996114 CTGATTCAGTAGGTCTGGACTGG + Intergenic
952238246 3:31502532-31502554 CTGATTCAGTAGGTCTACAGTGG + Intergenic
952311437 3:32194019-32194041 CTGATTCAGCAGGTCTGCATGGG + Intergenic
952410705 3:33047423-33047445 CTAATTCAGCAGGTCTGGAGTGG + Intronic
953129711 3:40126226-40126248 CTGATTCAGGAGGTCTGGATGGG - Intronic
953302205 3:41788984-41789006 CTGATTCAGAAGGTCTGCATGGG + Intronic
953344465 3:42163607-42163629 CTGATTCAGTAGGTCTGGAGTGG - Intronic
953370133 3:42380582-42380604 CTGATTCAGTAGGTCTAGGGTGG + Intergenic
953799575 3:46012004-46012026 CTGATTTAGTAGGTCTAGACAGG + Intergenic
956291184 3:67662000-67662022 CTGATTCAGTAGGTCTGTCTTGG + Intergenic
956725340 3:72152265-72152287 CTGATTCAGTAGGTCCAAAGTGG - Intergenic
956901232 3:73718101-73718123 CTATTTCAGTAGGTCCAGATGGG - Intergenic
956903099 3:73737089-73737111 CTGATTCAGTAGGTCTAGGGTGG - Intergenic
957248192 3:77738965-77738987 CTAATTCAGTAGGTCCAGTGGGG + Intergenic
957512280 3:81204388-81204410 CTGATTAAGTAGGTCTGAATGGG + Intergenic
957964481 3:87304764-87304786 CTAATTCTGTAGTTCTAGAATGG - Intergenic
958717803 3:97808169-97808191 CTATTTTAGTAGGTGTATAATGG - Intergenic
959571806 3:107892804-107892826 CTGATTCAGGAGGTCTAGAGTGG + Intergenic
960522373 3:118670213-118670235 CTAATTCAGTAGGTCTGGGGTGG + Intergenic
961093561 3:124136320-124136342 CTGATTCAGCAGGTCTACAGTGG + Intronic
961189174 3:124943092-124943114 CTGATTCAGTAGGCCTAGGTGGG - Intronic
961913074 3:130341379-130341401 ATAAATCGCTAGGTCTATATTGG + Intergenic
961994030 3:131221868-131221890 CTGATTCAGTAGGTCTGGAATGG - Intronic
962036295 3:131655236-131655258 CTGATTCAGTAGGTCTAGGGTGG - Intronic
962187822 3:133278870-133278892 CTAATTCATTAGGTCTGGGTGGG - Intronic
962425023 3:135262077-135262099 CTGATTCAGCAGGTCTAGAGTGG + Intergenic
962478958 3:135781984-135782006 CTAATTCAGTAGGTCTGTGTGGG - Intergenic
962482497 3:135809851-135809873 CTCATTCAGTAGGTCTAGGCTGG + Intergenic
962898819 3:139739015-139739037 CTAATTCAGTAGGTCTGGAATGG + Intergenic
962954557 3:140252439-140252461 CTGATTCAGTAGGCTTAGATAGG - Intronic
963415230 3:144986479-144986501 CTAATTCTGTAGGTCTAAAAGGG + Intergenic
963636416 3:147802843-147802865 CTAATTCTGTAAGTCTGTGTTGG - Intergenic
963709511 3:148730747-148730769 CTGATTCAGTAGGTCTGTGGTGG + Intronic
963966581 3:151378429-151378451 CTGATTCAGTTGGTCTAAAGCGG - Intronic
963970680 3:151426240-151426262 CTAATTCAGGAAGTCTAGAGAGG + Intronic
964231160 3:154469633-154469655 CTAAGTCAATAGGTCTAGAGTGG - Intergenic
964731190 3:159866969-159866991 CTGATTCAGTAGATCTAGGTGGG + Intronic
964807696 3:160629689-160629711 CTGATTCAGTAGGTCTGGAGTGG + Intergenic
965169188 3:165238974-165238996 CTAATTCAGTAGGTCCTAAGTGG - Intergenic
965531845 3:169778242-169778264 CAAATTCAGTAGGTCTGTGATGG - Intronic
965641012 3:170829075-170829097 CTGATTCAGTAGGTCTGGAAAGG - Intronic
965778019 3:172254309-172254331 CTGATTTAGTAGGTCTAAAATGG - Intronic
966424998 3:179771511-179771533 CTAATTCAGCAGGTCTGAAGTGG - Intronic
966449321 3:180039701-180039723 CTAATTCAGTAGGTCAGAAATGG - Intergenic
966999184 3:185315414-185315436 CTGATTCAGTAGGTCTGGTTGGG + Intronic
967710088 3:192696762-192696784 CTAGCTCAGTAGGTCTGTGTGGG + Intronic
967773809 3:193363533-193363555 TTAATTCAGTAGGTCTGAAGTGG - Intronic
967790843 3:193547408-193547430 CTAATTCAGTAGGTCTAGAATGG + Intronic
968197810 3:196723558-196723580 CTGATTCAGTAGGCCTAGATTGG + Intronic
969939367 4:10715226-10715248 CCAAGTCAGTAGGTCTAGAGAGG - Intergenic
969954730 4:10877235-10877257 CTGATTCAGTAGGTCTGGAGTGG - Intergenic
970334078 4:15015169-15015191 CAAATTCAGTAGGTCTGGAGTGG - Intronic
971055266 4:22906154-22906176 CTAACTCAGTAGGTCTGGGTGGG + Intergenic
971448634 4:26779102-26779124 CTGATTCAGTAGATCTAGTTTGG + Intergenic
972202096 4:36725643-36725665 CTAATTCAGTAGGTCTGGGCTGG - Intergenic
972613714 4:40678702-40678724 CTGATTCAGTAGGTCTGAAGTGG + Intergenic
972637703 4:40898909-40898931 CTGATTCAGTAGGTCTGGGTAGG + Intronic
972649165 4:40999673-40999695 CTGATTCAGTAGGTCTGGGTTGG - Intronic
972718168 4:41669503-41669525 CTCATTCAGTAGGTCTAGGCTGG + Intronic
974079795 4:57200189-57200211 CTAATTCAGTAGGTCAAGAGTGG - Intergenic
974101334 4:57421043-57421065 GTAGTTCAGAAAGTCTATATAGG - Intergenic
975630890 4:76401046-76401068 CTGATTCAGTAGGTCTAGAGTGG - Intronic
975874775 4:78823676-78823698 CTGAATCAGTAGGCCTATAATGG - Intronic
976033541 4:80788038-80788060 CTGATTCAGTAGGTCTGCAATGG + Intronic
977194185 4:94039007-94039029 CTGATTCAGTAAGTCTAAGTTGG + Intergenic
977769561 4:100841526-100841548 ATAATTTAGTAGGTCTGTAATGG + Intronic
978010990 4:103684334-103684356 CTCATTTATTAGGTCTATGTGGG - Intronic
978275806 4:106948294-106948316 CTGATTCAGTAGGTCTGTGTGGG + Intronic
978752437 4:112266006-112266028 CTATTTCTGTAGATCCATATAGG + Intronic
979341510 4:119529962-119529984 CTGATTCAGTAGGTCTGTGTTGG - Intronic
979415061 4:120427248-120427270 CTAATACAGTAGGTCTGGGTGGG - Intergenic
979632212 4:122916176-122916198 CTGATTCAGTAGGTCTATGGTGG - Intronic
979700713 4:123664350-123664372 CTTATTCACTAGGTTTATGTAGG + Intergenic
980632972 4:135461588-135461610 CTAAATCATTAAGTCTATAGAGG - Intergenic
980990802 4:139736734-139736756 CTAATTCAGGAGGCCTAGAGGGG - Intronic
982513483 4:156315004-156315026 CTAATTCAGTAGTTTAATCTTGG + Intergenic
983276505 4:165623894-165623916 CTAATTCTGTACTTCTAAATAGG + Intergenic
986415894 5:7527807-7527829 ATAATTCAGAAAGTGTATATTGG + Intronic
986771355 5:10976981-10977003 CTGATTCAGTAGGTCTGGAGTGG - Intronic
987171412 5:15262284-15262306 CTAATTCAGTAAGTCTGAACTGG - Intergenic
987814898 5:22887392-22887414 CTGATTCAGTAGGTATGGATTGG + Intergenic
988030363 5:25756087-25756109 CTAATTCAGAAGTTCTCTAAAGG - Intergenic
988909902 5:35828750-35828772 CTGATTCAGTAGGTCTGGAATGG + Intergenic
989512770 5:42307623-42307645 CTGATGCAGTCGGTCTAGATGGG - Intergenic
989788048 5:45355391-45355413 CTGATTCAGTAGGTCTGGAGTGG - Intronic
990173270 5:53079061-53079083 CTGATTCAGTAGGTCTAGGGTGG + Intronic
990758673 5:59104265-59104287 CTAACTCAGTAATTCTTTATGGG - Intronic
992072016 5:73157015-73157037 CTAATTCTGTAGGTCGAGGTGGG + Intergenic
992568864 5:78031178-78031200 CTAACTCAGTAGGTGAATAATGG - Intronic
992911124 5:81397116-81397138 CTAATTCAGTAGGTCTGAGTTGG - Intergenic
992974860 5:82104735-82104757 TTAAATCAGTAGGTCTCTAAAGG - Intronic
993684596 5:90922746-90922768 CTAATTCAGTAGGTCAGGTTGGG - Intronic
993707785 5:91190844-91190866 CTAATTCTGTAGGTCTACAATGG + Intergenic
994323257 5:98418065-98418087 CTAATTCAGCAGGTCTAAAGTGG + Intergenic
994852382 5:105072209-105072231 CTAATTCAATAGGTCTTTAGTGG - Intergenic
995149712 5:108828262-108828284 ATAATTCAGGAGGTATAAATAGG + Intronic
995539388 5:113169611-113169633 CAAATTCAGAAGCTCTATATGGG + Intronic
995962806 5:117864162-117864184 CTGATTCAGTAGGGCTAGAATGG - Intergenic
996167133 5:120238108-120238130 CTGATTCAGTAGATCTAGGTAGG - Intergenic
997893118 5:137692711-137692733 CTAATTCATTAGGTCTAGGATGG + Intronic
998202065 5:140132833-140132855 CTAATTCAGTAGGTTTGGAGTGG - Intergenic
998738746 5:145175143-145175165 CTGATTCAGTAGGTCTAGGATGG - Intergenic
999708895 5:154298880-154298902 TTGATTCAGTAGGTCTGGATGGG + Intronic
999823283 5:155249914-155249936 CTAATTCAGTCGGTTTAGAGCGG - Intergenic
999960713 5:156753105-156753127 CTGATTCAGTAAGTCTAGAGGGG - Intronic
1000254458 5:159524784-159524806 CTAATTCAGTAGGTCTGGGGTGG + Intergenic
1000703579 5:164483255-164483277 CTAATTTAGTAGGTCTGGAGTGG - Intergenic
1001716575 5:173821248-173821270 CTGATTCAGTAGGTCTAGGGTGG + Intergenic
1001719528 5:173845489-173845511 CTTATTCAGTAGGTCTAGGGTGG - Intergenic
1003680222 6:8245277-8245299 CTAGCTCAGTAGGTCCATGTGGG + Intergenic
1003877166 6:10448658-10448680 CTGAATCAGTAGGTCTAGAGTGG - Intergenic
1004113507 6:12745011-12745033 CTGATTCAGTAGGTTCAGATTGG + Intronic
1004338338 6:14784445-14784467 CCCATTCAGTAGGTCTCTGTTGG + Intergenic
1004684721 6:17932036-17932058 CTTATTCAGTAGGTCTGCAGTGG - Intronic
1004896706 6:20155221-20155243 CTAATTCAGTAGGTCTAGCGTGG - Intronic
1005387584 6:25300691-25300713 CTGATTTAGTAGGTCTAGATAGG - Intronic
1005792880 6:29325170-29325192 CTGATTCAGTAGGTCTGGAATGG - Intergenic
1006706124 6:36022971-36022993 CTGATTCAGTAGGTCTTGCTAGG + Intronic
1007459820 6:42009922-42009944 CTGATTCAGTAGGACTAAGTGGG - Intronic
1007650879 6:43420510-43420532 CTTATTCAGCAGGTCTAGAGTGG + Intergenic
1007949560 6:45859344-45859366 CTGATTCAGTAGGTCTAGGGAGG + Intergenic
1007981408 6:46163175-46163197 CAAATTCAGTAGGTCTGTTTTGG + Intronic
1009848218 6:69161517-69161539 CTGATTCAGTAGGTCTGTAATGG + Intronic
1009876161 6:69507960-69507982 CATATTCAGTAGGTCTAGATTGG + Intergenic
1010443964 6:75930747-75930769 CTGATTCAGTAGGTCTGGATGGG - Intronic
1010745204 6:79552698-79552720 CTTATTCTGTAGGTCTGGATTGG - Intergenic
1011952892 6:92989692-92989714 CTGATTCAGCAGGTCTGGATGGG - Intergenic
1012033456 6:94102002-94102024 CTGATTCAGTAGGTCTGCAAGGG - Intergenic
1012215134 6:96573157-96573179 CTTTTTCAGTAGGTTTATATTGG - Intronic
1014076076 6:117235971-117235993 CTGATTCAGTAGGTCTAGGATGG + Intergenic
1014282927 6:119461952-119461974 CTGATTCAGTAGGTCTGAAGTGG + Intergenic
1014598530 6:123377421-123377443 CTGATTCAGTAGGTCTTGAGTGG + Intronic
1014687032 6:124514463-124514485 CTAATTCAGTAGGTCTAGGATGG - Intronic
1015135661 6:129866932-129866954 CTAATTCAGTAGGTCTTGGGAGG + Intergenic
1015726571 6:136305634-136305656 CTGATTCAGTAGTTCTATGGCGG - Intergenic
1015958649 6:138624249-138624271 CTAATTCAGTAGGTCTAGGGTGG + Intronic
1016001752 6:139048890-139048912 CTAATTTAGTAGATCTGGATGGG + Intergenic
1016628160 6:146196691-146196713 CTGATTCAGTAGGTTTGGATGGG - Intronic
1017379031 6:153805939-153805961 CTGATTCAGTAGGTCTCGAGTGG - Intergenic
1017531696 6:155299170-155299192 GTAATTCATTAGGTCGATAAGGG - Intronic
1017684718 6:156900386-156900408 CTCATTCAGTATTTCTATAGTGG + Intronic
1018249051 6:161850002-161850024 CTAACTCAGTAAATGTATATTGG - Intronic
1020431292 7:8118910-8118932 CTGATTCAGTAGGTCAGCATTGG - Intronic
1021064440 7:16156085-16156107 ATAACTCAGTAAGTCTATACAGG - Intronic
1021283737 7:18752930-18752952 CTAATTCAGTAAGTCTGGAGTGG + Intronic
1021559134 7:21951724-21951746 CTGATTCAGTAGGTCCAGAAGGG - Intergenic
1022194870 7:28055105-28055127 GTCATTTAGTAAGTCTATATTGG - Intronic
1022834128 7:34097597-34097619 CTGATTCAGTGGGTCTAGGTGGG + Intronic
1023332597 7:39134341-39134363 CTGATTCAGTAGGTCTGGAGTGG + Intronic
1023395216 7:39745642-39745664 CTGATTCAGCAGGTCTAGAAGGG + Intergenic
1024304168 7:47912996-47913018 CTGATTCAGTAGGTCTGCAGTGG + Intronic
1024618185 7:51133513-51133535 CTGATTCAGTAGGTCTGGATGGG - Intronic
1024901812 7:54326759-54326781 CTAATTCACAAGCTCTATATTGG + Intergenic
1025016046 7:55439924-55439946 CTGATTCAGTAGGTCTGGGTGGG + Intronic
1026195655 7:68171196-68171218 CTGATTCAGTAGGTCTGCACTGG - Intergenic
1026207850 7:68273727-68273749 CTGAGTCAATAGGTCAATATAGG + Intergenic
1026336307 7:69396931-69396953 CTGATTCAGTAGGTCTGGGTAGG + Intergenic
1026364164 7:69630777-69630799 CTGATTCAGTAGGTCTTGAGTGG - Intronic
1027775104 7:82455099-82455121 CTGATTCAGTAGGTCTGGGTGGG + Intergenic
1028568375 7:92258437-92258459 CTAATTCAGTAAGTCTGAGTGGG + Intronic
1028649605 7:93136994-93137016 CTGATTCAGTAGGTCTAAGTGGG - Intronic
1028732588 7:94168998-94169020 CTGATTCAATAGGTCTGGATTGG + Intergenic
1028863261 7:95678856-95678878 CTGACTCAGTAGGTCTACGTGGG - Intergenic
1030297501 7:107943647-107943669 CTGATTCAGTAGGTCTGGGTGGG + Intronic
1030407298 7:109130254-109130276 CTGATTTAGTAGGTCTTTAGAGG + Intergenic
1031912701 7:127534420-127534442 CTAATTCAGTTGGTCTGGAATGG - Intergenic
1032746006 7:134786944-134786966 CTGATTCGGTAGGTCTAGAAGGG + Intronic
1033007151 7:137578592-137578614 CTAATTCAGTAGATCTGGCTAGG - Intronic
1033046370 7:137965954-137965976 CTAATTCAGTAGGTCTGCAGTGG + Intronic
1034783110 7:153900074-153900096 CTGATTCAGTAGGTCTGGGTGGG - Intronic
1035917816 8:3644161-3644183 CTGATTCAGTAAGTCTACATTGG - Intronic
1036609943 8:10341070-10341092 CTAATTCAGTAGGTCTGAGTGGG - Intronic
1038478169 8:27883518-27883540 CTCTTTCAGTAGGTCTGGATTGG - Intronic
1038945694 8:32357154-32357176 CAAGTTCAGAAGGTCTGTATGGG - Intronic
1039303489 8:36235919-36235941 CTAATTCAGTGGGTCTGGAGTGG - Intergenic
1039400456 8:37264971-37264993 CTGATTCAGTAGGTCTGGGTTGG - Intergenic
1040416688 8:47202025-47202047 CTGATTCAGTAGGTCTAGGTTGG + Intergenic
1040508313 8:48071556-48071578 CTAATTCAGTAGGTCTATGGTGG + Intergenic
1040676322 8:49755377-49755399 CTAATTCAGTTTATCTATGTCGG - Intergenic
1042555450 8:70030643-70030665 CTAACTCACTAGTTGTATATTGG + Intergenic
1042925989 8:73969181-73969203 ATAAATCAGAAGTTCTATATGGG - Intronic
1043160091 8:76836322-76836344 CTGATTCAGTAGGTCTGGGTTGG - Intronic
1044203438 8:89463537-89463559 CTGATTCAGTAGGTCTGGATAGG + Intergenic
1044577497 8:93786570-93786592 CTAATTCAGCAGGTCTAGAGTGG - Intronic
1045003402 8:97897157-97897179 CTGATTCAGTAGGTCTGGGTTGG + Intronic
1045455645 8:102376306-102376328 CTGATTTAGTAGGTTTAAATGGG - Intronic
1045847363 8:106654121-106654143 TTAAATCAGTAGATCAATATGGG - Intronic
1046391419 8:113577534-113577556 CAAATACAGTAGGTGTATTTTGG + Intergenic
1046714796 8:117555903-117555925 TTAATTCAGTAGGTCTAGAGTGG + Intergenic
1046772893 8:118134558-118134580 CTGGTTCAGTAGGTCTAGAGTGG - Intergenic
1047685524 8:127301566-127301588 CTAATTCAGTAGGCCTGGAGTGG - Intergenic
1047889334 8:129290615-129290637 CTAATTCAGTAGTTTTCCATCGG - Intergenic
1048633173 8:136266673-136266695 CTAATTCAGAAGATCTAGCTTGG + Intergenic
1050001337 9:1079823-1079845 CTGATTCAGTAGGTCTGGACAGG + Intergenic
1050112571 9:2231991-2232013 CTGATTCAGTAGGTCTGGAGTGG + Intergenic
1051805049 9:20983169-20983191 CTGATTCAGTAGGCCTAGATGGG - Intronic
1051942565 9:22526247-22526269 CAGATTCAGTAGGTCTAGAATGG + Intergenic
1052216614 9:25973475-25973497 CTGATTCAGTAGGTCTGGGTGGG - Intergenic
1052379001 9:27749907-27749929 CTGATTCAGTAGGTCTAGCGTGG - Intergenic
1053200757 9:36150212-36150234 CTGATTCAGTAGGTCTACAGAGG - Intronic
1055148109 9:72960666-72960688 CTGATTCAGTAGGTCTAAGATGG - Intronic
1055275433 9:74610847-74610869 CTGATTCAGTAGGTCTGGAATGG + Intronic
1055918198 9:81429362-81429384 CTGTTTCAGTAGGTCAAAATTGG + Intergenic
1056289643 9:85129722-85129744 CTAATTCAGAAGGTCTAGAATGG - Intergenic
1057396145 9:94682297-94682319 CTGATTCAGTAGGTCTCAAGAGG + Intergenic
1058018583 9:100066045-100066067 CTCATTCAGTGGGTCTAGAGTGG - Intronic
1058327978 9:103721929-103721951 CAAATTCAGAAGGCCTATGTGGG - Intergenic
1058600658 9:106666323-106666345 CTCATTCAGTAGGTTTTTGTGGG + Intergenic
1058637531 9:107050830-107050852 CTAATTCAGTTGGTCTGAAGTGG + Intergenic
1058909973 9:109512029-109512051 CTAATTTGGTAGGTCTAATTTGG + Intergenic
1059048745 9:110899659-110899681 CTGATTCAGTAGGTCTGGAGTGG + Intronic
1059210585 9:112511258-112511280 CTGATTCAGTATGTCTGTCTGGG - Intronic
1059520999 9:114942047-114942069 CTAATTTAGTAGGTCTGTAGGGG + Intergenic
1059720407 9:116954370-116954392 CTAATTTAGTTTGTCTAGATTGG + Intronic
1186404542 X:9290402-9290424 CTGATTCAGCAGGTCTAGGTCGG + Intergenic
1186433239 X:9522326-9522348 GTATTTCAGTAGCTCCATATGGG + Intronic
1186806962 X:13149652-13149674 CTGATTCAGTAGGTCTAAGGTGG - Intergenic
1186842816 X:13501999-13502021 CTAATTCAGAAGTTATATAAAGG + Intergenic
1187177148 X:16906166-16906188 CTAATTCAGTAGGTCGAGGGTGG - Intergenic
1187712448 X:22067758-22067780 CTAATTCAGTAGGTCTGGGGTGG - Intronic
1188511067 X:30937154-30937176 CTGATTCAATAGGTCTCAATTGG + Intronic
1189051035 X:37645836-37645858 CTAATTCGGTAGGTCTAGGATGG - Intronic
1189219424 X:39358414-39358436 CTCATTCAGTAGGTCTGCGTAGG + Intergenic
1189252801 X:39614148-39614170 CTGATTCAGTAGGTCTAGGCGGG - Intergenic
1189269130 X:39738169-39738191 TTAATTCAGTAGGTCTCAGTGGG - Intergenic
1189402615 X:40685987-40686009 CATACTCATTAGGTCTATATAGG + Intronic
1189456518 X:41195415-41195437 CTGATTCAGGAGGTCTGCATTGG + Intronic
1189647933 X:43154443-43154465 CTGATTCAGTAGTTCTAAAATGG + Intergenic
1189937587 X:46086045-46086067 CTATTTCAATAGGTATATAGTGG - Intergenic
1190787533 X:53666202-53666224 CTAATTCAGTAGGTCTGAAGTGG + Intronic
1191600431 X:62999535-62999557 CTAATTGAGGAGATCTCTATTGG + Intergenic
1192415707 X:70978658-70978680 CTGATTCAGTAGGTTTGGATGGG - Intergenic
1192609073 X:72549516-72549538 CTAATTCAGTAGGTCTGAGATGG - Intronic
1193946767 X:87747011-87747033 CTTATTCAGAAGGTCTGAATTGG + Intergenic
1194578708 X:95644275-95644297 TTGATTCAGTAGGTCTAGTTTGG + Intergenic
1194599676 X:95904738-95904760 TAAATTCAGTAGCTCTATTTAGG + Intergenic
1194610007 X:96031589-96031611 CTTATTCAGAAGGTCTGTACTGG + Intergenic
1194758721 X:97768548-97768570 CTAATTCAATAGGTCTGGAGTGG + Intergenic
1195125337 X:101803319-101803341 CTGATTCAGTAGGTCTAGGATGG - Intergenic
1195179410 X:102342358-102342380 CTGATTCAGTAGGTCTAGGGTGG + Intergenic
1195526605 X:105898087-105898109 CTGATTCAAAAGGTCTATGTAGG + Intronic
1196070458 X:111515602-111515624 CTGATTCAGTAGCTCTGTATGGG - Intergenic
1196174392 X:112625110-112625132 CTGATTCAGTAGGTCTGAAGTGG + Intergenic
1196495873 X:116324542-116324564 CTGATTCAGTAGGTTTAGAGTGG + Intergenic
1196892148 X:120301676-120301698 CTGATTCAGTTGGTCTGCATGGG - Intronic
1197201057 X:123748982-123749004 CTAATTCAGTAGGTCTAGGGTGG + Intergenic
1197338344 X:125235209-125235231 CTGATTCATTAGGTCTATCATGG - Intergenic
1197836707 X:130702270-130702292 CTGATTCAGTAGGTCTGTGCTGG + Intronic
1197961000 X:132006132-132006154 CTGATTCAGTAGGTCTGGAGTGG - Intergenic
1198058992 X:133024834-133024856 CTGAATCAGTAGGTCTACAGTGG + Intronic
1198234626 X:134725481-134725503 CTGATTCAGTAGGTCTAGAATGG + Intronic
1198558117 X:137817987-137818009 CTAATTCAGTAGCTTCATTTGGG + Intergenic
1198765572 X:140076184-140076206 CTGATTCAGTAGGTCTGGGTTGG - Intergenic
1198774141 X:140161795-140161817 CTAATTCAGTAGATTTAGAGTGG - Intergenic
1199037984 X:143076342-143076364 CGAATTCAGTAGGTCTTTATGGG + Intergenic
1199149288 X:144410774-144410796 TTAATTCAGTAGCTCTAGATTGG + Intergenic
1199675489 X:150185749-150185771 CTAAATCAGTAGGTCTTCAGTGG - Intergenic
1200456454 Y:3400172-3400194 CTAATCCAGGAGATATATATAGG - Intergenic
1201470658 Y:14331145-14331167 CTGATTCAGTAGGTCTGGAGTGG + Intergenic
1201958128 Y:19648424-19648446 CTAATTTGGGAGGTCTCTATAGG - Intergenic
1202587607 Y:26448324-26448346 CTCATTCAGTAGGTCTGGAGTGG - Intergenic