ID: 1150371117

View in Genome Browser
Species Human (GRCh38)
Location 17:64638936-64638958
Sequence CTGTGGGCACTTTTGGGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 234}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150371117_1150371124 3 Left 1150371117 17:64638936-64638958 CCAGACCCCAAAAGTGCCCACAG 0: 1
1: 0
2: 2
3: 23
4: 234
Right 1150371124 17:64638962-64638984 TTCCAATGCCACCCAACATAAGG 0: 1
1: 0
2: 1
3: 13
4: 120
1150371117_1150371132 29 Left 1150371117 17:64638936-64638958 CCAGACCCCAAAAGTGCCCACAG 0: 1
1: 0
2: 2
3: 23
4: 234
Right 1150371132 17:64638988-64639010 AGTGTAACAAAGGGGAAGTCAGG 0: 1
1: 0
2: 0
3: 12
4: 179
1150371117_1150371129 19 Left 1150371117 17:64638936-64638958 CCAGACCCCAAAAGTGCCCACAG 0: 1
1: 0
2: 2
3: 23
4: 234
Right 1150371129 17:64638978-64639000 CATAAGGAAGAGTGTAACAAAGG 0: 1
1: 0
2: 1
3: 30
4: 241
1150371117_1150371131 21 Left 1150371117 17:64638936-64638958 CCAGACCCCAAAAGTGCCCACAG 0: 1
1: 0
2: 2
3: 23
4: 234
Right 1150371131 17:64638980-64639002 TAAGGAAGAGTGTAACAAAGGGG 0: 1
1: 0
2: 1
3: 23
4: 289
1150371117_1150371130 20 Left 1150371117 17:64638936-64638958 CCAGACCCCAAAAGTGCCCACAG 0: 1
1: 0
2: 2
3: 23
4: 234
Right 1150371130 17:64638979-64639001 ATAAGGAAGAGTGTAACAAAGGG 0: 1
1: 0
2: 1
3: 36
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150371117 Original CRISPR CTGTGGGCACTTTTGGGGTC TGG (reversed) Intronic
900421285 1:2557018-2557040 ATGTGGGCACTTCTGGGGGCTGG + Intronic
901628153 1:10635106-10635128 CAGGGGGCAGTTTTGGGGTCTGG + Intergenic
903391354 1:22965521-22965543 CTGTGGGCTCTTGTGATGTCTGG - Intergenic
904645072 1:31959422-31959444 CTATGGGCAACTGTGGGGTCTGG - Intergenic
904883290 1:33716665-33716687 CTCTGGGCACTTGTGTGTTCAGG - Intronic
906069703 1:43007770-43007792 CTGCGTGGGCTTTTGGGGTCGGG + Intergenic
909514320 1:76490129-76490151 CCGTGGGCTATTTTCGGGTCAGG - Intronic
910422322 1:87079778-87079800 CTGTGAGCACTTTGGGATTCTGG + Intronic
913078816 1:115363327-115363349 CTGTGGCCACATCTGGGTTCAGG - Intergenic
915750065 1:158198935-158198957 CTGTTGGCACTTTGGTGGCCAGG + Intergenic
916181807 1:162091316-162091338 CTATTGGCTCTTTTGGGTTCAGG + Intronic
917218953 1:172706902-172706924 CTAGGGGAACTTTTAGGGTCTGG - Intergenic
920180684 1:204130196-204130218 CTGGGGTCACCTGTGGGGTCAGG - Intergenic
920353285 1:205352021-205352043 CTGTGGGCCCTTTATGGGGCTGG + Intronic
922464945 1:225840113-225840135 CTGTGGGCAGCATTGGGGTGGGG - Intronic
922823853 1:228503525-228503547 CTGCGAGCACTTTTGGGATGAGG + Intergenic
923524606 1:234762815-234762837 CTTTGGACATTTTTGGGATCTGG - Intergenic
924707468 1:246511536-246511558 CCATGGGCAGTTTTGGGGGCTGG - Intergenic
924743132 1:246809374-246809396 CTGTGGGCACTTTGGGCCTCTGG + Intergenic
1064344187 10:14515944-14515966 CTGGGGGCTGTTTTGGGGTGGGG + Intergenic
1067792449 10:49298480-49298502 CTGTGGGCAGTTTGGGGAGCAGG + Intergenic
1069878231 10:71576125-71576147 CTGAGGGCACTTTTGTCGCCAGG + Intronic
1071354735 10:84783420-84783442 CTCTGTGCACTTCTGGGGGCAGG + Intergenic
1072763351 10:98076628-98076650 CTGGGGTCACATTTAGGGTCTGG + Intergenic
1074219582 10:111423326-111423348 CTGTAGGCACTTTTAGTGTTTGG - Intergenic
1075316704 10:121459053-121459075 CAGTGGGCTCTGCTGGGGTCTGG - Intergenic
1075848714 10:125568325-125568347 GGGTGAGCACTTTTGGGCTCCGG - Intergenic
1077399160 11:2344811-2344833 CTGAGTGTACTTTTAGGGTCTGG - Intergenic
1077475303 11:2786996-2787018 CTGTGGGAATTTTTGAAGTCTGG + Intronic
1078175000 11:8963962-8963984 CTGTGGGCACTGTCGGGGCTGGG + Intronic
1081782331 11:45721829-45721851 CCGTGGCCATTCTTGGGGTCTGG - Intergenic
1082557458 11:54579568-54579590 CTGGGGACAGTTTTGGGGTGTGG + Intergenic
1083366530 11:62144906-62144928 CTGTGGGCAGCTTTTGGGGCTGG + Intronic
1084095340 11:66907602-66907624 CTGTGGGGACTGTTCTGGTCAGG - Intronic
1084146062 11:67266114-67266136 CTGTGATCACGTTTGGTGTCAGG + Intergenic
1084226111 11:67715699-67715721 CTGTGGGCACTGGAGGGGGCGGG - Intergenic
1084477871 11:69399052-69399074 CTGTGGGCACGTGAGGGGTGGGG - Intergenic
1084524599 11:69687872-69687894 CTGTGGGTAGTTCTGGGGACAGG - Intergenic
1084524722 11:69689111-69689133 CTGTGGGTGCTTCTGGGGACAGG - Intergenic
1084809469 11:71603545-71603567 CTGTGGGCACTGGGGGGGGCGGG + Intergenic
1085386956 11:76162975-76162997 ATCTGGGGACCTTTGGGGTCAGG + Intergenic
1088777556 11:113100291-113100313 GGGTGAGCACTTTTGGGCTCTGG + Intronic
1088913989 11:114213054-114213076 CTGTGGGCACACAGGGGGTCGGG - Intronic
1089142454 11:116296877-116296899 CTGTGGTCATTTTTGGCATCTGG + Intergenic
1090081059 11:123613107-123613129 CTGTGGTTCCTTTTGGGGTGAGG - Intronic
1092214787 12:6673347-6673369 ATGTGGGCACTTGTGGGGCTTGG + Exonic
1093942456 12:25069354-25069376 CTGGGGCCACTTGTGGGGCCTGG - Exonic
1094182439 12:27606305-27606327 CTGCAGGCATTTTTGGGGTATGG + Intronic
1094270541 12:28609498-28609520 CTGTGAGGAAATTTGGGGTCAGG + Intergenic
1094820751 12:34222359-34222381 CTGTTGGCAATTTTGGGTTTGGG + Intergenic
1094876184 12:34645495-34645517 GTGGGGCCAGTTTTGGGGTCTGG + Intergenic
1096134649 12:49189156-49189178 CTCTGGGCAGATTGGGGGTCTGG - Exonic
1098202427 12:68069734-68069756 ATGTGGGCACCTTTGGGTTTAGG + Intergenic
1098917790 12:76275372-76275394 CTATGGGCAAATTTGGAGTCTGG - Intergenic
1100164907 12:91906046-91906068 CTGTGGGCAATTTGGGCCTCTGG + Intergenic
1100478158 12:94952998-94953020 GGGTGAGCACTTTTGGGCTCTGG - Intronic
1103571322 12:121846985-121847007 CTGGGGGCTCTTGTAGGGTCAGG - Intronic
1103721565 12:122978220-122978242 CTGTGGACACTTGTAGAGTCTGG + Intronic
1104165875 12:126229279-126229301 CTGAGTGCTGTTTTGGGGTCTGG + Intergenic
1105323904 13:19352983-19353005 CTATGGGCTCTTGTGGGGTAGGG - Intergenic
1105571897 13:21610898-21610920 CAGTGCACACTCTTGGGGTCTGG - Intergenic
1105870049 13:24496550-24496572 CTATGGGCTCTTGTGGGGTAGGG + Intronic
1106752690 13:32791285-32791307 CTTAGGGCACTATTGGGGTGGGG + Intergenic
1109127880 13:58540881-58540903 GTATATGCACTTTTGGGGTCAGG - Intergenic
1111799980 13:92969512-92969534 CACTGGGAACATTTGGGGTCAGG - Intergenic
1112110749 13:96295700-96295722 CTCTGGACAGTTTTGGTGTCTGG + Intronic
1112558746 13:100493135-100493157 GGGTGAGCACTTTTGGGCTCTGG - Intronic
1113758845 13:112833579-112833601 CTGAAGGCACTTTTGGGGAGGGG - Intronic
1114666581 14:24380927-24380949 CAGTGGGCTATTTTGGAGTCTGG - Intergenic
1116498936 14:45596824-45596846 CTGGGGACAGTTGTGGGGTCAGG - Intergenic
1116563820 14:46419148-46419170 CTGGGGACAGTTGTGGGGTCGGG - Intergenic
1117680259 14:58196635-58196657 CTAAGAACACTTTTGGGGTCTGG + Intronic
1118074645 14:62284652-62284674 CTGTGGGGACTTTTGTGGGGTGG - Intergenic
1119028644 14:71174303-71174325 GTGTAGGCAGTTTTGGGGTTTGG + Intergenic
1119385603 14:74256579-74256601 CTGTGGTCACACTTGGTGTCTGG + Intronic
1119913350 14:78371630-78371652 GGGTGAGCACTTTTGGGCTCTGG - Intronic
1121413721 14:93764432-93764454 CTGTGGACAGCTTTGGGGGCGGG - Intronic
1122051273 14:99062011-99062033 CTGTGGGAGCTTTGGGGGTCTGG + Intergenic
1124463962 15:29919653-29919675 CCCTGGGCATTTTGGGGGTCTGG + Intronic
1125416234 15:39456242-39456264 CTGTGTGAACTTTTGGGTTCAGG - Intergenic
1125768154 15:42148672-42148694 CTCTGGGCACCTTTGGTGCCTGG - Intronic
1127177504 15:56376058-56376080 CTGGGGACTCTTGTGGGGTCGGG + Intronic
1128759068 15:70203076-70203098 CTATGGCCTCATTTGGGGTCTGG + Intergenic
1129558396 15:76538553-76538575 CTGTGGACTGTTGTGGGGTCGGG + Intronic
1131259414 15:90880819-90880841 CTGGGGGCACTTGAGGGGTAGGG + Intronic
1131741860 15:95401421-95401443 TTATAGCCACTTTTGGGGTCTGG - Intergenic
1134246043 16:12540925-12540947 CCCTGCCCACTTTTGGGGTCAGG + Intronic
1134748322 16:16605197-16605219 CTGTGGGCCCTGTTGGTATCTGG + Intergenic
1134997141 16:18748418-18748440 CTGTGGGCCCTGTTGGTATCTGG - Intergenic
1135295268 16:21274149-21274171 CTGTGGGAACGATTGGAGTCTGG - Intronic
1135810712 16:25584379-25584401 CTGTGGGGACTGTTGGGGGGTGG - Intergenic
1136615445 16:31395608-31395630 CTGTGGGGTCTCTTGGGGTTGGG - Intronic
1137479073 16:48836265-48836287 CTGTGGTCAGTTGGGGGGTCAGG + Intergenic
1137953205 16:52803161-52803183 CTGTGATCACCTTTGGGGTTTGG - Intergenic
1138353635 16:56360681-56360703 CTGTGGGCTCTTTTGGAATGAGG - Intergenic
1139568784 16:67797365-67797387 CTGTGGCCACTTTTCTGGTAGGG - Intronic
1139772326 16:69288111-69288133 CTGTGGGCAGTCGAGGGGTCAGG + Intronic
1140594540 16:76393517-76393539 CTGTGAGCACTTTGGGGCCCAGG - Intronic
1141576342 16:84966465-84966487 CTGAGCCCACCTTTGGGGTCTGG - Intergenic
1141933878 16:87223337-87223359 ATGTGGGCACTTGTGGGCACTGG - Intronic
1142184566 16:88688414-88688436 CTGCGAGCACCTTTGGGGTGGGG + Intergenic
1142279056 16:89138237-89138259 CTGATGGCACATTTGAGGTCAGG + Intronic
1146471507 17:33128587-33128609 CTGTGGGGAGTTTTGGAGTGGGG + Intronic
1147651105 17:42062524-42062546 CTGTGGGATCTTTTGGGATCAGG - Intronic
1147910479 17:43853208-43853230 CTGTGACCACTTCTGGGATCTGG - Intronic
1148894130 17:50830342-50830364 CTGTGGAAACTTTTAGGGTGGGG + Intergenic
1149435165 17:56627849-56627871 CTGTGGGCACTTGAGGGCCCAGG - Intergenic
1149566667 17:57645188-57645210 CTGTGGGCAGGGTTGGGGCCAGG + Intronic
1150371117 17:64638936-64638958 CTGTGGGCACTTTTGGGGTCTGG - Intronic
1151155972 17:72123264-72123286 CTGTGTGTGCTTTTGGGGTGGGG - Intronic
1152322364 17:79614900-79614922 CTGGGGGCCCTATGGGGGTCGGG - Intergenic
1153688333 18:7567675-7567697 CTGTTGGCACTTTGGGGGCTTGG + Exonic
1156344771 18:36247028-36247050 CTGTGGCCACTCTGGGGGTGGGG + Intronic
1158698864 18:59728533-59728555 CAGTGGGCACTTTTGTGGTGTGG - Intergenic
1159846626 18:73468921-73468943 CTGTGGCCTGTTGTGGGGTCAGG - Intergenic
1163041961 19:14609283-14609305 CAGTGGTCTCTGTTGGGGTCAGG + Intronic
1163356237 19:16813124-16813146 GTGTGTGCACTTCTGGGCTCAGG + Intronic
1163691096 19:18738945-18738967 CTGGGGGCACTTTGGGGCTTGGG + Intronic
1163766577 19:19166424-19166446 CTGGGATCCCTTTTGGGGTCAGG - Intronic
1164780902 19:30891750-30891772 CTATGGACACTTTTGGGATCTGG - Intergenic
1165752148 19:38266720-38266742 CTGTGGTAACTTCTGGGGACTGG + Intronic
1165898542 19:39157200-39157222 CTGTGTGTGGTTTTGGGGTCGGG + Intronic
1167301598 19:48680869-48680891 CCGTGGGCACCTTCGGGGTCTGG + Intergenic
1168145438 19:54417858-54417880 CTGTGGGCATTTGTGTGTTCTGG - Intronic
925178475 2:1800938-1800960 CTGTGGGCAATGTGAGGGTCGGG + Intronic
927367200 2:22311462-22311484 GTGTTGGCAGTTTTGGTGTCTGG - Intergenic
928748420 2:34442891-34442913 CTGTGGGCATTTTGGGGTCCAGG + Intergenic
929144880 2:38697926-38697948 CTGTTGGCAATTTTGGGTTTTGG + Intronic
930322573 2:49875214-49875236 CTGGGGACAGTTGTGGGGTCGGG - Intergenic
930556550 2:52903092-52903114 CTGTGGCCACCTTGGGGGTGGGG + Intergenic
932070374 2:68613803-68613825 CTGGGGTCTCTTTTGGGGTGGGG - Intronic
932698317 2:73975637-73975659 CTGTGGGCACTCCTGGGGCAAGG - Intergenic
932970029 2:76529322-76529344 CTGTGGGCAATTTTGGGATCTGG + Intergenic
933808381 2:86016692-86016714 CTGTGGGCTTCGTTGGGGTCTGG + Intergenic
933846163 2:86328825-86328847 GGGTGAGCACTTTTGGGCTCTGG + Intronic
938159013 2:128967332-128967354 CTGGGGACGGTTTTGGGGTCGGG + Intergenic
938211037 2:129465777-129465799 CTGGGGGCAGGTTTGGTGTCTGG - Intergenic
938224922 2:129607326-129607348 CTGTGGCCCCTTTTGGGTTGGGG - Intergenic
938242798 2:129756279-129756301 CTGTCGGCCCTTCTGGGCTCTGG - Intergenic
940794403 2:158061762-158061784 CTGTGTGCAGGTTTGTGGTCTGG + Intronic
941548650 2:166886562-166886584 CTGTTGGCACATTTGGGGTTTGG - Intergenic
944900549 2:204209810-204209832 CTCTGGGCACTACTGGGGTTGGG + Intergenic
946328108 2:218995201-218995223 CTGTGAGCACTTTTTGGCACGGG - Intergenic
947269157 2:228314288-228314310 CTATGGGCACTTTCAGGATCTGG + Intergenic
948085584 2:235244129-235244151 CAGTGGGCAGGTGTGGGGTCTGG - Intergenic
949035370 2:241813653-241813675 CTGTGGGCGCTTCTCAGGTCAGG + Intronic
1169022305 20:2339501-2339523 CTGTGGGCTCTGTGAGGGTCAGG - Intronic
1169506927 20:6221068-6221090 CAGTGGGTAGTTTTTGGGTCTGG + Intergenic
1171072857 20:22092227-22092249 GTGTGAGCACTTTTGGGCTCTGG + Intergenic
1171768686 20:29303978-29304000 CTCTGGGCACTTGTGGAGTGGGG - Intergenic
1173007434 20:39150995-39151017 CTCTGGGGCCTTTTGGGGTAGGG + Intergenic
1173448808 20:43143987-43144009 CTGCTGGGACTTTTGGGTTCTGG + Intronic
1173929367 20:46806030-46806052 CCGCGGGCGCTGTTGGGGTCTGG - Intergenic
1174169325 20:48606389-48606411 CTTTGAGCACTTTTAGGGGCTGG - Intergenic
1174197605 20:48784752-48784774 CTGTGGGCTCAGGTGGGGTCAGG - Intronic
1174397500 20:50256920-50256942 CAGAGGCCACTCTTGGGGTCAGG - Intergenic
1175277430 20:57781781-57781803 TTGTGGTCACTTTTGGAGTAGGG + Intergenic
1179073100 21:38091397-38091419 CTGGGGGCTGTTGTGGGGTCAGG + Intronic
1180606137 22:17060290-17060312 CAGTGGGCACCGTGGGGGTCAGG - Intergenic
1183045469 22:35216111-35216133 CTGTGGGCAGATTTGGTGTTTGG + Intergenic
1184108865 22:42383757-42383779 CCCTGGGCACATTTGGGGTTGGG + Exonic
1184138171 22:42561738-42561760 CTGTGGGCTGTTTTGGCCTCGGG + Intronic
1184875667 22:47273953-47273975 CTCTGGGCACTTTAGGGCACTGG - Intergenic
949256794 3:2057860-2057882 CAGTGGGAACTTCTGAGGTCAGG - Intergenic
952327568 3:32335002-32335024 CTGCTGGCACATTTGGGGGCTGG + Intronic
953337317 3:42104250-42104272 CTGGGGGCACTTCTGGGGGCAGG + Intronic
954553347 3:51499902-51499924 CTGTGGCCACTGGCGGGGTCGGG - Exonic
957039727 3:75327857-75327879 CTGTGTGGGCTTTTGGGGTCTGG - Intergenic
959397167 3:105854992-105855014 CTGTGGGTATTTTTGGAATCTGG + Intronic
960153124 3:114271373-114271395 CTGTGGGCACTGTGGGGGATAGG + Intergenic
961044478 3:123699291-123699313 CTGTGTGGACTTTTGGGGTCTGG - Intronic
962252381 3:133843749-133843771 ATGTAGGCATCTTTGGGGTCAGG + Intronic
962347310 3:134627627-134627649 CTGGGGCCACCTTTGGGTTCAGG - Intronic
964464741 3:156978807-156978829 CTGAGCTCACTTTTGTGGTCTGG - Intronic
966298230 3:178449019-178449041 CTTTGGGCATCTTTGTGGTCAGG - Intronic
968062094 3:195733362-195733384 CTGTTGCCACATCTGGGGTCAGG - Exonic
969454604 4:7294241-7294263 CTGTGGGCAGATTTGGGGTGGGG + Intronic
969718207 4:8878576-8878598 CTGTGGTCACTTTAAGGCTCCGG + Intergenic
971598918 4:28568195-28568217 CTGTGGCTGCTTTTAGGGTCTGG + Intergenic
973067968 4:45821448-45821470 GAGTGAGCACTTTTGGGCTCTGG + Intergenic
976802492 4:89008238-89008260 CTGTGGGCACATTGGGGGCTAGG - Intronic
978569123 4:110117215-110117237 CTATTGGCATTTTTGGGGGCTGG - Intronic
980097080 4:128502177-128502199 GTGTGAGCACTTTTGGGCTCCGG - Intergenic
983934569 4:173492396-173492418 CTGTGGGTAGTTTTGGGGTGGGG - Intergenic
986004657 5:3657730-3657752 CTGCGGACAATTTTGGGATCCGG + Intergenic
986165520 5:5268921-5268943 TGGTGGGCAGTTGTGGGGTCGGG - Intronic
987434922 5:17883244-17883266 CTGTGGTCACTGTTGGGGGTAGG + Intergenic
987479187 5:18431643-18431665 CTGGGGGCCTTTTGGGGGTCAGG - Intergenic
990804663 5:59645453-59645475 CTGTGGGCCATTTTGGGATCTGG + Intronic
991090589 5:62690464-62690486 CTGTGGCCACTTTAGGAGTCAGG - Intergenic
992458453 5:76938369-76938391 CTTTGGGGATTTTTGGGTTCTGG + Intergenic
995080035 5:108040131-108040153 CTGTGGGCATTTTTGCTGTTTGG + Intronic
997076736 5:130687588-130687610 CTGTTGGCATGTTTGGGTTCTGG - Intergenic
997372453 5:133370632-133370654 CTTTGGGCAGTCTTGGGGTTTGG + Intronic
998155989 5:139787639-139787661 ACGGGGGCTCTTTTGGGGTCGGG - Intergenic
999867221 5:155714100-155714122 CTGGGGCCACTTGTGGGGTGGGG - Intergenic
1000083354 5:157867925-157867947 CTGTGGCCACTGCTGGTGTCAGG + Intergenic
1001281482 5:170389321-170389343 CTGTGGCCTCTTTTGGGGTGGGG - Exonic
1002186737 5:177458141-177458163 CTGAGGGCAGAGTTGGGGTCTGG + Exonic
1006006344 6:31004830-31004852 CTGAGGGCACCTCTGTGGTCAGG + Intergenic
1008227424 6:48937188-48937210 CTGTGGCCACTTCTGGGGGATGG + Intergenic
1009670311 6:66740539-66740561 GTGTGGGCTCTTTTGAGCTCAGG - Intergenic
1010346352 6:74815263-74815285 GGGTGAGCACTTTTGGGTTCTGG + Intergenic
1011219857 6:85042821-85042843 ATGTGGGGAGTTTTGGGGGCTGG - Intergenic
1012705263 6:102518980-102519002 CAGTGGGGACTTTGGGGTTCAGG + Intergenic
1013884513 6:114945906-114945928 CTGTGTGCAGTTTAGGGTTCTGG - Intergenic
1015564483 6:134553690-134553712 CTGTGATCACTTTTGAGCTCTGG - Intergenic
1016902185 6:149113745-149113767 GGGTGAGCACTTTTGGGCTCTGG - Intergenic
1017522226 6:155212814-155212836 CAGTGAGCACGTGTGGGGTCTGG + Intronic
1018035406 6:159877281-159877303 CAGTGGGCTGGTTTGGGGTCTGG + Intergenic
1019057491 6:169233801-169233823 GTGTGGGCAGTTGTGTGGTCTGG - Intronic
1019136863 6:169914556-169914578 CTGTGGGCACTGCAGGGTTCTGG + Intergenic
1019479552 7:1260218-1260240 GTGTGGGCTCCTTTGGGGACTGG - Intergenic
1020515078 7:9107406-9107428 CTTTGGACCCATTTGGGGTCTGG + Intergenic
1021952412 7:25788160-25788182 CTGTGGGCTGGTCTGGGGTCTGG - Intergenic
1024210847 7:47202251-47202273 CTGTAGGCACCTCTGAGGTCAGG - Intergenic
1024714432 7:52059292-52059314 CTTTGGGCAAATTTGGGTTCAGG + Intergenic
1024730782 7:52251569-52251591 CTTTGGGCACATGTGGGGACAGG - Intergenic
1026929540 7:74216192-74216214 CAGGGGGCAGTTTAGGGGTCAGG - Intronic
1027422073 7:78026643-78026665 CTGTGGGCAATGGTGGGGTTCGG + Intronic
1029068009 7:97871973-97871995 CTGTGGACATTTTCGCGGTCCGG - Exonic
1029892058 7:103940802-103940824 CTGTGGAAACTTTTGGTTTCAGG - Intronic
1029922707 7:104282515-104282537 CTGGGGACTGTTTTGGGGTCGGG + Intergenic
1029931518 7:104376215-104376237 TTGTGGGCACTTTTTGTGCCAGG + Intronic
1032520189 7:132538005-132538027 ATGTGAGCAGGTTTGGGGTCGGG - Intronic
1035625961 8:1070869-1070891 TTGTCGGCAATTGTGGGGTCTGG - Intergenic
1038072349 8:24031035-24031057 CTGGGGGCACTTTTAAGGTTCGG + Intergenic
1039841249 8:41294803-41294825 CTGTGTGGGCTTTTGGGGTTGGG - Intronic
1041026733 8:53694346-53694368 CTGGGGCCTCTTGTGGGGTCGGG - Intergenic
1042337575 8:67644643-67644665 CTGTGGGGACTTTTAGGATTTGG + Intronic
1042621828 8:70715266-70715288 CTGTGGGCATTTTGGGGATGTGG - Intronic
1042640038 8:70923699-70923721 TTGTGGGCACTTTTAGTGTCTGG + Intergenic
1043163966 8:76880126-76880148 GTGTGGGCATATTTGGTGTCTGG - Intergenic
1044774933 8:95678087-95678109 CTGTTGTCTCTTTTTGGGTCTGG + Intergenic
1046194015 8:110835280-110835302 CTGGGGACTCTTTTGGGATCTGG - Intergenic
1046699603 8:117385241-117385263 ATGTCAGCTCTTTTGGGGTCTGG - Intergenic
1049325823 8:142020949-142020971 CTGTCAGCCCTTTTGGGGACTGG + Intergenic
1051833015 9:21301803-21301825 CTCTGGCCAGTTTTGGTGTCAGG - Intergenic
1053146679 9:35716829-35716851 CTCTGAAAACTTTTGGGGTCAGG + Intronic
1059507991 9:114817311-114817333 CTGGGGGCACTTTTGGCCGCAGG + Intergenic
1060210108 9:121704945-121704967 CCATGGGCACCTTTGGGGGCAGG + Intronic
1060729342 9:126027377-126027399 CTGGGGGCACGAGTGGGGTCAGG + Intergenic
1061150045 9:128823301-128823323 GTGTACCCACTTTTGGGGTCAGG - Intronic
1061160871 9:128892988-128893010 CTGTGGGCCCACATGGGGTCTGG + Intronic
1061674414 9:132207771-132207793 CTGTGGGCACTTGGGGGTACTGG - Intronic
1062153472 9:135033320-135033342 CGGTGGGTGCTTTTAGGGTCTGG - Intergenic
1203783653 EBV:115307-115329 CTGGCGGCACTGTGGGGGTCGGG - Intergenic
1186481092 X:9896277-9896299 CTGTGGGCACGTTTGCTGACAGG + Exonic
1186762686 X:12739901-12739923 CTGTGGGCATTTTTGGGAAATGG - Intergenic
1186819689 X:13274716-13274738 ATGTGGGCACTTTTGGTGGAAGG - Intergenic
1187707820 X:22025154-22025176 GGGTGAGCACTTTTGGGCTCTGG + Intergenic
1189413057 X:40790918-40790940 TTGTGAGCACTTTTGGGCTCCGG + Intergenic
1189639332 X:43050909-43050931 CTGTGGCCACTGTAGGGGACAGG + Intergenic
1190517038 X:51234652-51234674 ATGTGGGCACTTTTGGGGGAGGG - Intergenic
1195086905 X:101421586-101421608 GTGTGGGCAGGTTTGGTGTCTGG + Intronic
1197716927 X:129716135-129716157 GTGTGAGCACTTTTAGGGACTGG - Intergenic
1198941362 X:141960129-141960151 CTGTGGGAACTTTTAGGGTAGGG + Intergenic
1198995996 X:142574872-142574894 CTGTGGGGACTTTAGGGGAGTGG + Intergenic
1199143705 X:144339726-144339748 CTGTGGGCTCTGGTGGGTTCTGG - Intergenic
1199978474 X:152907948-152907970 GTGTGGGCACATTTCTGGTCAGG - Intergenic