ID: 1150376871

View in Genome Browser
Species Human (GRCh38)
Location 17:64688719-64688741
Sequence GGAGTTTGGCCCTGCTGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150376871_1150376876 1 Left 1150376871 17:64688719-64688741 CCTGGGCAGCAGGGCCAAACTCC No data
Right 1150376876 17:64688743-64688765 TCTCTAAAAACAAATAGGCCGGG No data
1150376871_1150376875 0 Left 1150376871 17:64688719-64688741 CCTGGGCAGCAGGGCCAAACTCC No data
Right 1150376875 17:64688742-64688764 ATCTCTAAAAACAAATAGGCCGG No data
1150376871_1150376873 -4 Left 1150376871 17:64688719-64688741 CCTGGGCAGCAGGGCCAAACTCC No data
Right 1150376873 17:64688738-64688760 CTCCATCTCTAAAAACAAATAGG No data
1150376871_1150376877 9 Left 1150376871 17:64688719-64688741 CCTGGGCAGCAGGGCCAAACTCC No data
Right 1150376877 17:64688751-64688773 AACAAATAGGCCGGGCACAGTGG 0: 6
1: 87
2: 961
3: 5461
4: 20441
1150376871_1150376879 28 Left 1150376871 17:64688719-64688741 CCTGGGCAGCAGGGCCAAACTCC No data
Right 1150376879 17:64688770-64688792 GTGGCTGACACCTGTAATCCCGG 0: 9
1: 1240
2: 3317
3: 4911
4: 5370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150376871 Original CRISPR GGAGTTTGGCCCTGCTGCCC AGG (reversed) Intergenic
No off target data available for this crispr