ID: 1150376872

View in Genome Browser
Species Human (GRCh38)
Location 17:64688733-64688755
Sequence TTGTTTTTAGAGATGGAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150376872_1150376881 25 Left 1150376872 17:64688733-64688755 CCAAACTCCATCTCTAAAAACAA No data
Right 1150376881 17:64688781-64688803 CTGTAATCCCGGCATTTTGCAGG No data
1150376872_1150376877 -5 Left 1150376872 17:64688733-64688755 CCAAACTCCATCTCTAAAAACAA No data
Right 1150376877 17:64688751-64688773 AACAAATAGGCCGGGCACAGTGG 0: 6
1: 87
2: 961
3: 5461
4: 20441
1150376872_1150376879 14 Left 1150376872 17:64688733-64688755 CCAAACTCCATCTCTAAAAACAA No data
Right 1150376879 17:64688770-64688792 GTGGCTGACACCTGTAATCCCGG 0: 9
1: 1240
2: 3317
3: 4911
4: 5370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150376872 Original CRISPR TTGTTTTTAGAGATGGAGTT TGG (reversed) Intergenic
No off target data available for this crispr