ID: 1150376877

View in Genome Browser
Species Human (GRCh38)
Location 17:64688751-64688773
Sequence AACAAATAGGCCGGGCACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 26956
Summary {0: 6, 1: 87, 2: 961, 3: 5461, 4: 20441}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150376871_1150376877 9 Left 1150376871 17:64688719-64688741 CCTGGGCAGCAGGGCCAAACTCC No data
Right 1150376877 17:64688751-64688773 AACAAATAGGCCGGGCACAGTGG 0: 6
1: 87
2: 961
3: 5461
4: 20441
1150376867_1150376877 23 Left 1150376867 17:64688705-64688727 CCACTGCACTCCAGCCTGGGCAG 0: 2283
1: 73292
2: 180736
3: 244256
4: 185273
Right 1150376877 17:64688751-64688773 AACAAATAGGCCGGGCACAGTGG 0: 6
1: 87
2: 961
3: 5461
4: 20441
1150376870_1150376877 13 Left 1150376870 17:64688715-64688737 CCAGCCTGGGCAGCAGGGCCAAA No data
Right 1150376877 17:64688751-64688773 AACAAATAGGCCGGGCACAGTGG 0: 6
1: 87
2: 961
3: 5461
4: 20441
1150376872_1150376877 -5 Left 1150376872 17:64688733-64688755 CCAAACTCCATCTCTAAAAACAA No data
Right 1150376877 17:64688751-64688773 AACAAATAGGCCGGGCACAGTGG 0: 6
1: 87
2: 961
3: 5461
4: 20441

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150376877 Original CRISPR AACAAATAGGCCGGGCACAG TGG Intergenic
Too many off-targets to display for this crispr