ID: 1150376879

View in Genome Browser
Species Human (GRCh38)
Location 17:64688770-64688792
Sequence GTGGCTGACACCTGTAATCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 14847
Summary {0: 9, 1: 1240, 2: 3317, 3: 4911, 4: 5370}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150376872_1150376879 14 Left 1150376872 17:64688733-64688755 CCAAACTCCATCTCTAAAAACAA No data
Right 1150376879 17:64688770-64688792 GTGGCTGACACCTGTAATCCCGG 0: 9
1: 1240
2: 3317
3: 4911
4: 5370
1150376874_1150376879 7 Left 1150376874 17:64688740-64688762 CCATCTCTAAAAACAAATAGGCC No data
Right 1150376879 17:64688770-64688792 GTGGCTGACACCTGTAATCCCGG 0: 9
1: 1240
2: 3317
3: 4911
4: 5370
1150376871_1150376879 28 Left 1150376871 17:64688719-64688741 CCTGGGCAGCAGGGCCAAACTCC No data
Right 1150376879 17:64688770-64688792 GTGGCTGACACCTGTAATCCCGG 0: 9
1: 1240
2: 3317
3: 4911
4: 5370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150376879 Original CRISPR GTGGCTGACACCTGTAATCC CGG Intergenic
Too many off-targets to display for this crispr