ID: 1150376881

View in Genome Browser
Species Human (GRCh38)
Location 17:64688781-64688803
Sequence CTGTAATCCCGGCATTTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150376878_1150376881 -3 Left 1150376878 17:64688761-64688783 CCGGGCACAGTGGCTGACACCTG 0: 83
1: 6547
2: 27917
3: 75840
4: 140587
Right 1150376881 17:64688781-64688803 CTGTAATCCCGGCATTTTGCAGG No data
1150376872_1150376881 25 Left 1150376872 17:64688733-64688755 CCAAACTCCATCTCTAAAAACAA No data
Right 1150376881 17:64688781-64688803 CTGTAATCCCGGCATTTTGCAGG No data
1150376874_1150376881 18 Left 1150376874 17:64688740-64688762 CCATCTCTAAAAACAAATAGGCC No data
Right 1150376881 17:64688781-64688803 CTGTAATCCCGGCATTTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150376881 Original CRISPR CTGTAATCCCGGCATTTTGC AGG Intergenic
No off target data available for this crispr