ID: 1150383625

View in Genome Browser
Species Human (GRCh38)
Location 17:64740278-64740300
Sequence ACCAAAAATGTCTCCAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150383623_1150383625 -10 Left 1150383623 17:64740265-64740287 CCGAGAAGTGACAACCAAAAATG No data
Right 1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG No data
1150383618_1150383625 18 Left 1150383618 17:64740237-64740259 CCACTAGATGACAGTAGCATCCT No data
Right 1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG No data
1150383617_1150383625 30 Left 1150383617 17:64740225-64740247 CCTGGTCACTATCCACTAGATGA No data
Right 1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG No data
1150383619_1150383625 -2 Left 1150383619 17:64740257-64740279 CCTCCTCCCCGAGAAGTGACAAC No data
Right 1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG No data
1150383622_1150383625 -9 Left 1150383622 17:64740264-64740286 CCCGAGAAGTGACAACCAAAAAT No data
Right 1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG No data
1150383620_1150383625 -5 Left 1150383620 17:64740260-64740282 CCTCCCCGAGAAGTGACAACCAA No data
Right 1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG No data
1150383621_1150383625 -8 Left 1150383621 17:64740263-64740285 CCCCGAGAAGTGACAACCAAAAA No data
Right 1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150383625 Original CRISPR ACCAAAAATGTCTCCAGGCC AGG Intergenic
No off target data available for this crispr