ID: 1150386781

View in Genome Browser
Species Human (GRCh38)
Location 17:64767715-64767737
Sequence TCTAGGGCCACCCCTCCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150386771_1150386781 23 Left 1150386771 17:64767669-64767691 CCAACACCCACAGGCTCACTGGC No data
Right 1150386781 17:64767715-64767737 TCTAGGGCCACCCCTCCAAGTGG No data
1150386777_1150386781 -8 Left 1150386777 17:64767700-64767722 CCATCCCTTCTCCACTCTAGGGC No data
Right 1150386781 17:64767715-64767737 TCTAGGGCCACCCCTCCAAGTGG No data
1150386772_1150386781 17 Left 1150386772 17:64767675-64767697 CCCACAGGCTCACTGGCAGAGAC No data
Right 1150386781 17:64767715-64767737 TCTAGGGCCACCCCTCCAAGTGG No data
1150386773_1150386781 16 Left 1150386773 17:64767676-64767698 CCACAGGCTCACTGGCAGAGACC No data
Right 1150386781 17:64767715-64767737 TCTAGGGCCACCCCTCCAAGTGG No data
1150386774_1150386781 -5 Left 1150386774 17:64767697-64767719 CCACCATCCCTTCTCCACTCTAG No data
Right 1150386781 17:64767715-64767737 TCTAGGGCCACCCCTCCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150386781 Original CRISPR TCTAGGGCCACCCCTCCAAG TGG Intergenic
No off target data available for this crispr