ID: 1150388123

View in Genome Browser
Species Human (GRCh38)
Location 17:64776216-64776238
Sequence CCCTACCCTGGACTTTGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150388116_1150388123 0 Left 1150388116 17:64776193-64776215 CCCTTGTGGGGGCAGGACCAACT No data
Right 1150388123 17:64776216-64776238 CCCTACCCTGGACTTTGTTGGGG No data
1150388117_1150388123 -1 Left 1150388117 17:64776194-64776216 CCTTGTGGGGGCAGGACCAACTC No data
Right 1150388123 17:64776216-64776238 CCCTACCCTGGACTTTGTTGGGG No data
1150388106_1150388123 30 Left 1150388106 17:64776163-64776185 CCTGGGACAACTAAGGGCAGGGG No data
Right 1150388123 17:64776216-64776238 CCCTACCCTGGACTTTGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150388123 Original CRISPR CCCTACCCTGGACTTTGTTG GGG Intergenic
No off target data available for this crispr