ID: 1150396258

View in Genome Browser
Species Human (GRCh38)
Location 17:64824281-64824303
Sequence TAGTTACAACAGAGGTTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150396258_1150396265 23 Left 1150396258 17:64824281-64824303 CCACACAACCTCTGTTGTAACTA No data
Right 1150396265 17:64824327-64824349 AAAAAGGCTGTTCCTGCTAAAGG No data
1150396258_1150396261 7 Left 1150396258 17:64824281-64824303 CCACACAACCTCTGTTGTAACTA No data
Right 1150396261 17:64824311-64824333 CTGCCCCAGTGTGGCAAAAAAGG No data
1150396258_1150396266 26 Left 1150396258 17:64824281-64824303 CCACACAACCTCTGTTGTAACTA No data
Right 1150396266 17:64824330-64824352 AAGGCTGTTCCTGCTAAAGGTGG No data
1150396258_1150396260 -2 Left 1150396258 17:64824281-64824303 CCACACAACCTCTGTTGTAACTA No data
Right 1150396260 17:64824302-64824324 TATGTAATTCTGCCCCAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150396258 Original CRISPR TAGTTACAACAGAGGTTGTG TGG (reversed) Intergenic
No off target data available for this crispr