ID: 1150399237

View in Genome Browser
Species Human (GRCh38)
Location 17:64843990-64844012
Sequence CTGTAGTCCCAGATATTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150399233_1150399237 -3 Left 1150399233 17:64843970-64843992 CCGTGTGCAGTCACGCGCACCTG No data
Right 1150399237 17:64843990-64844012 CTGTAGTCCCAGATATTGGAGGG No data
1150399232_1150399237 26 Left 1150399232 17:64843941-64843963 CCTATCTCTACAAAAAATTTAAA 0: 787
1: 3905
2: 19551
3: 138257
4: 295876
Right 1150399237 17:64843990-64844012 CTGTAGTCCCAGATATTGGAGGG No data
1150399231_1150399237 27 Left 1150399231 17:64843940-64843962 CCCTATCTCTACAAAAAATTTAA 0: 119
1: 1897
2: 7299
3: 37761
4: 219683
Right 1150399237 17:64843990-64844012 CTGTAGTCCCAGATATTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150399237 Original CRISPR CTGTAGTCCCAGATATTGGA GGG Intergenic
No off target data available for this crispr