ID: 1150403278

View in Genome Browser
Species Human (GRCh38)
Location 17:64876892-64876914
Sequence ATGTCTTTAGTTTGGATACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 4, 1: 0, 2: 5, 3: 28, 4: 235}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150403278_1150403281 23 Left 1150403278 17:64876892-64876914 CCTGGTATCCAAACTAAAGACAT 0: 4
1: 0
2: 5
3: 28
4: 235
Right 1150403281 17:64876938-64876960 GTATTTCTTATGAATGTAGATGG 0: 3
1: 2
2: 0
3: 16
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150403278 Original CRISPR ATGTCTTTAGTTTGGATACC AGG (reversed) Intronic
900772032 1:4553018-4553040 ATGCCTTTAGTTTGAATGCAGGG - Intergenic
903568421 1:24286104-24286126 ATGTTTTTATTTTTGATACTGGG + Intergenic
904148526 1:28415988-28416010 ATGTCTTGAGTTTGGCTCCTTGG - Intronic
904733757 1:32614395-32614417 ATGTCTTTAGTGTTTATACTGGG + Intronic
908021084 1:59899691-59899713 ATGACTTTAGTTTCTATACTTGG + Intronic
908127623 1:61046812-61046834 ATGACTATAGTTTAGATGCCAGG + Intronic
909383523 1:75029643-75029665 ATGTCTTTGGTTTTGGTATCAGG - Intergenic
909762978 1:79316330-79316352 ATTTCTCTAGTGTGGATACAAGG + Intergenic
910733486 1:90425117-90425139 ATGTCTTTAGTTTTGGTGTCAGG - Intergenic
911926795 1:103842879-103842901 ATGTATTTATTTTTGATACAGGG - Intergenic
912898924 1:113626436-113626458 ATGTCTTTGATTTGGATATCAGG + Intronic
915501166 1:156319010-156319032 TTGTCTTTTGTTCAGATACCTGG - Exonic
915803513 1:158819494-158819516 ATGTTTTTCATTTTGATACCAGG + Intergenic
916517657 1:165534698-165534720 ATCTCTTCAGTTTTGTTACCTGG - Intergenic
916915057 1:169397527-169397549 ATGTATTTGGTTTGGATACTAGG - Intronic
919711159 1:200730179-200730201 ATCTTTTTAGTTAGGATACTAGG - Intergenic
919841584 1:201613244-201613266 ATGTATTTATTTTGGAAACTTGG + Intergenic
919994413 1:202735145-202735167 ATATCTTTAGTTAGCATTCCTGG + Intronic
920144616 1:203848310-203848332 ATGTCTTTAATGTGAATACAGGG + Exonic
921108206 1:212005032-212005054 ATTTCTTTAGAGTGTATACCTGG - Intronic
922941781 1:229473239-229473261 GTGTTTTTTGTTTGGATACAGGG - Intronic
1064508282 10:16058822-16058844 ATGTCTTTGGTTTTTGTACCAGG - Intergenic
1066101929 10:32125148-32125170 ATGTCTTTTGTTAGAATCCCAGG - Intergenic
1068016287 10:51520649-51520671 CTTTCTTTTCTTTGGATACCAGG - Intronic
1068563957 10:58550020-58550042 ATTTATTTAGTTTGGAGACAGGG + Intronic
1069644532 10:69983531-69983553 ATATCTTTGGTTTTGATACTAGG - Intergenic
1069803324 10:71097595-71097617 ATGTCTTTGGTTTAGGTATCAGG + Intergenic
1070635347 10:78121866-78121888 ATGTCTTTGGTTTTGATATCTGG - Intergenic
1070822229 10:79365575-79365597 ATGTCTTTGGTTTTGACATCAGG - Intergenic
1071221187 10:83466436-83466458 ATGTCTTTAATTTTAATATCAGG - Intergenic
1072169281 10:92844471-92844493 ATGTCTTTGGGTTGGATTCTTGG - Intronic
1072413105 10:95223355-95223377 ATGTCTTTGGTTTTGGTATCAGG - Intronic
1072796587 10:98360573-98360595 ATTTATTTATTTTGGATACAGGG + Intergenic
1073852581 10:107638208-107638230 ATGTGTCTAGCTTGGACACCAGG + Intergenic
1073947149 10:108764316-108764338 ATGGCCTGAGTTTGAATACCAGG + Intergenic
1074422483 10:113321740-113321762 CTGTTTTCAGTATGGATACCAGG + Intergenic
1076376987 10:129996608-129996630 GTGTCTTTGGTTTTGATATCAGG - Intergenic
1077859584 11:6164251-6164273 ATGTCTTTGGTTTTGGTACAAGG - Intergenic
1077989456 11:7390829-7390851 CCGTTTTTAGTTTGGATATCGGG + Intronic
1078995691 11:16696340-16696362 ATGTCTTTATTTTACATATCAGG - Intronic
1079505883 11:21151285-21151307 ATGTCTTTGGTTTGAAAACCAGG + Intronic
1081028351 11:38044904-38044926 AGGCCTTTACTTTGAATACCAGG + Intergenic
1082971249 11:59023654-59023676 ATGTCTTTGGTTTTAGTACCAGG - Intronic
1083062219 11:59885793-59885815 ATGTCTTTGGTTTTAATATCAGG + Intergenic
1086481918 11:87249788-87249810 ATGTGTTTGGTTTTGATATCAGG + Intronic
1086972511 11:93098895-93098917 ATTTCTTTAGTATGGATATGTGG - Intergenic
1088455483 11:110028768-110028790 ATGACTTGAGGTTGGGTACCAGG - Intergenic
1089327082 11:117664726-117664748 TTGTCATTAGTTTGTAAACCAGG - Intronic
1090261873 11:125327137-125327159 AAGTCTTTAGTTTGGGTCTCTGG + Intronic
1090656721 11:128851810-128851832 ATGTCTTCAGTATGGACACTCGG + Intronic
1091055862 11:132418323-132418345 ATGCCTTTATTTTGAATCCCAGG + Exonic
1091141842 11:133241942-133241964 ATGGTTTTAGCTGGGATACCAGG - Intronic
1091941577 12:4488541-4488563 TTGTCTTTAGTGTTGTTACCTGG + Exonic
1092642736 12:10534495-10534517 ATGTCTTTGGTTTTGGTATCAGG - Intergenic
1092786984 12:12035753-12035775 ATATGTTTAGTTTGGATTACTGG - Intergenic
1093659356 12:21736516-21736538 ATGTCTTAGGTTTGGTTCCCTGG + Intronic
1094240511 12:28217769-28217791 AAGGCTTTAGTTTGGATGCAGGG + Intronic
1095491169 12:42735099-42735121 ATGTGTCTAGCATGGATACCTGG - Intergenic
1095833543 12:46612967-46612989 ATGTCTTTCCTTTGAATACCAGG + Intergenic
1097561499 12:61212191-61212213 ATTTATTTAGTTTGGTTCCCTGG - Intergenic
1100563524 12:95772673-95772695 ATGTTTTTAGTTTGAGCACCTGG - Intronic
1100645380 12:96523797-96523819 ATGTATTTAGTTTTGCTACCAGG - Intronic
1100723953 12:97388507-97388529 ATGTGTTTAGTTTAGAGACAAGG + Intergenic
1101166805 12:102045252-102045274 ATTTCTCTAGTTTGGAAACCCGG - Intronic
1101603645 12:106231834-106231856 ATGACTTCAGTTTGGATCCGAGG + Intergenic
1101665896 12:106814141-106814163 TTTTCTGTAGTTTGTATACCAGG + Intronic
1103430147 12:120877377-120877399 AGGTCTTTAGTTTTGGTATCAGG - Intronic
1103640861 12:122350823-122350845 ATGTTTTTTGTCTGGAGACCTGG - Intronic
1104101104 12:125610859-125610881 ACTTCTTTGGTTTTGATACCAGG + Intronic
1106521681 13:30503924-30503946 ATGTCTTTATTTTGGAGGCAGGG - Intronic
1107571051 13:41658584-41658606 ATGTTTCTAGTTTGGATGTCTGG - Intronic
1108138324 13:47390020-47390042 ATGTCTTCGGTTTGGGTATCAGG - Intergenic
1110212434 13:72989199-72989221 ATTTCTTTTGTTTATATACCTGG - Intronic
1110249062 13:73361093-73361115 TTATCTATAGTTTGAATACCTGG + Intergenic
1110273076 13:73613187-73613209 ATTTCTTTAGGTTAAATACCTGG + Intergenic
1110387127 13:74926076-74926098 ATGTCTTTGGTTTTGATATCTGG - Intergenic
1111796659 13:92929096-92929118 ATGTCTTTAGTTTGGGTGTCAGG - Intergenic
1112454605 13:99547580-99547602 ATCTCATTATTTTGGAGACCTGG + Intronic
1112545202 13:100361546-100361568 AGTTCTTTATTTTGGATACAAGG - Intronic
1116310186 14:43315505-43315527 AGGTCTTTTGTTTGGAAAACTGG + Intergenic
1116987492 14:51237070-51237092 ATGTCTTTGGTTTTGCTATCAGG - Intergenic
1117961475 14:61166960-61166982 ATGTCTTTGGTTTTGGTATCAGG + Intergenic
1117996431 14:61482481-61482503 ATGTCTTTGTTTTTTATACCTGG + Intronic
1118679874 14:68229723-68229745 ATGTCCTTTGTTTGGAAACAGGG - Intronic
1119107214 14:71936218-71936240 ATTTCTTTAGTTTTGAGACTTGG - Intronic
1123413482 15:20078605-20078627 ATGCCTTTGGTTTTGGTACCAGG + Intergenic
1123522824 15:21085717-21085739 ATGCCTTTGGTTTTGGTACCAGG + Intergenic
1124148030 15:27148514-27148536 ATGTCTTTGGCTTGGAGATCAGG - Intronic
1124176187 15:27426392-27426414 ATGTCCTCAGCTTGGACACCAGG - Intronic
1125446081 15:39758433-39758455 ATGTCTATAGTTTGGAAACCAGG - Intronic
1126876171 15:53044180-53044202 ATGTGATGAGTTTGGATACATGG - Intergenic
1129369494 15:75080690-75080712 ATGTCTTTGTTTTGGGTATCGGG - Intronic
1129576231 15:76749032-76749054 ATGTCTTTGGTTTTGGTAACAGG - Intronic
1130731875 15:86502890-86502912 ATATCTTTGGTTTTGCTACCCGG + Intronic
1134313995 16:13101495-13101517 ACGCCTTCAGTTTGGTTACCTGG - Intronic
1134434771 16:14246469-14246491 CTGTCTTCAGTTCTGATACCTGG - Exonic
1137063233 16:35811110-35811132 ATGTGTTTTTTTTGGATACTAGG - Intergenic
1138109637 16:54313300-54313322 ATGTCTTTGTTTTGGAGTCCTGG + Intergenic
1138808314 16:60119483-60119505 ATGTCTTTATTTTGCCTACATGG + Intergenic
1140203487 16:72913817-72913839 TTGTCTTTGTTTTGCATACCTGG + Intronic
1140551083 16:75866376-75866398 ATGTTTTAAGTTTTCATACCTGG + Intergenic
1148277119 17:46314813-46314835 ATGTCTTTAGTTTGGATACCAGG + Intronic
1148299235 17:46532389-46532411 ATGTCTTTAGTTTGGATACCAGG + Intronic
1148363854 17:47037595-47037617 ATGTCTTTAGTTTGGATACCAGG + Intronic
1150403278 17:64876892-64876914 ATGTCTTTAGTTTGGATACCAGG - Intronic
1150600687 17:66648271-66648293 ATATCTTCAGATTGGATTCCCGG - Intronic
1151721530 17:75859308-75859330 ATGTATTTATTTTTGATACAGGG + Intergenic
1153372068 18:4329850-4329872 ATGTCTTTGGTTTTGGTAGCAGG + Intronic
1154282929 18:13023702-13023724 ATGTCTTTAGTTTGGGTATTAGG + Intronic
1155771120 18:29701294-29701316 ATGACTTTACTTTGGAAACCAGG + Intergenic
1156423617 18:36983788-36983810 TTGTCTTTGGTTTGCATATCAGG - Intronic
1156557677 18:38085921-38085943 ATGTCTTTGTTTATGATACCTGG - Intergenic
1157887628 18:51384051-51384073 ATGTCTTTAGCTTGCATTCCTGG - Intergenic
1158870329 18:61680809-61680831 ATGTCTTTGGTTTGAGTATCCGG - Intergenic
1162539138 19:11283275-11283297 ATGTCTGGAGTCTGGATACCTGG - Intergenic
1164283921 19:23793460-23793482 ATGTATTTTGTTTGGAGACAGGG + Intronic
928091917 2:28379888-28379910 ATGGGCTTAGTTTTGATACCAGG + Intergenic
931062055 2:58541157-58541179 ATGTTTTTAGTTTTCATGCCAGG - Intergenic
931090182 2:58877385-58877407 ATGACTTTAGTTTGCAAGCCTGG - Intergenic
931090910 2:58885046-58885068 GTGTTTTTAGGTTGAATACCTGG + Intergenic
932410030 2:71541104-71541126 ATTTCTTTGGTTTTGATATCTGG + Intronic
933855256 2:86407407-86407429 ATGTCTTTGGTTTTGGTATCAGG - Intergenic
935093513 2:99920227-99920249 ATGTCTTTGGTTTTGGTACTAGG - Intronic
938321252 2:130366572-130366594 ATGTCTTTGGTTTTGGTGCCAGG + Intronic
939078642 2:137633045-137633067 CTGTCTTTAGTTTGCAGATCAGG + Intronic
939508009 2:143072777-143072799 ATGTCTTTAGTTTGGCCACTGGG - Intergenic
939683601 2:145169954-145169976 ATCTCTATAGTTTTGATATCAGG + Intergenic
939921143 2:148115482-148115504 AGGTATTTAGTATGGGTACCTGG + Intronic
941022726 2:160426176-160426198 CTTTCTTTCGTTTGGACACCAGG - Intronic
941265960 2:163362850-163362872 ATGTCTTTGGTTTTGATATTAGG + Intergenic
943170400 2:184390254-184390276 ATGTCTTTGGTTTTGGTATCAGG - Intergenic
943220632 2:185099995-185100017 ATATCTTTGGTTTTGATATCAGG - Intergenic
944592678 2:201232651-201232673 ATGTCTTTACTCTGCATGCCAGG + Intergenic
945713760 2:213332550-213332572 GTGTCTTTGGTTTGGGTATCAGG - Intronic
945744683 2:213705561-213705583 ATGACTTTGGTTTGGAAACTTGG + Intronic
945954658 2:216075140-216075162 ATGCCTATAGTTTAGATACTTGG + Intronic
945964690 2:216174008-216174030 ATGTCTTTGGTTTTGGTAACAGG + Intronic
946108679 2:217394780-217394802 GTGTCTTTAGTTTCCAAACCGGG + Intronic
947137424 2:226988897-226988919 AAGGCTTTATTTTGGATAACTGG - Intronic
947684113 2:232066541-232066563 ATGTCTTTGGTTTTGGTATCAGG + Intronic
949058127 2:241940397-241940419 ATGGCTTTAGTTTTTGTACCAGG - Intergenic
1169955504 20:11098267-11098289 ATGTCTTTAGTCACGCTACCTGG - Intergenic
1169974677 20:11311322-11311344 CTGCCTTTAATGTGGATACCAGG - Intergenic
1170041321 20:12042844-12042866 AAGTCTCAAGTTTGGATACCTGG - Intergenic
1172018668 20:31897002-31897024 CTGTCTTTGGTTTTGATATCAGG + Intronic
1172400283 20:34644967-34644989 ATGTCTTTACTTTGAATTCATGG - Intronic
1174493947 20:50925708-50925730 ATGTTGTTAGTTTGGAAACTCGG - Intronic
1178616451 21:34138063-34138085 ATGTCTTTGGTTTGGGTATAGGG + Intronic
1179116412 21:38497359-38497381 ATGTCTTTAGTTTTGCTGCACGG - Intronic
1180028857 21:45187963-45187985 ATGTCTTTGGCTTTGATATCAGG + Intronic
1182387748 22:29960116-29960138 ATGTATTTAATTTTGATGCCAGG + Intronic
1183646886 22:39132206-39132228 CTGTCTTTGGTTTGGGAACCAGG + Exonic
1185010309 22:48309192-48309214 ATGCCTTCAGTGTGGATTCCTGG - Intergenic
952186121 3:30970870-30970892 ATCTCTTTAGGTTGGATAAATGG + Intergenic
953894053 3:46780794-46780816 ATGTCTTTGGTTTGGATATTAGG - Intronic
958146776 3:89634512-89634534 TTGTTTTGAGTTTTGATACCTGG - Intergenic
958187817 3:90145906-90145928 ATGTCTGAAGTATGGAAACCAGG - Intergenic
959058966 3:101598536-101598558 ATGACTTTGGTTTGGGTATCAGG + Intergenic
959558200 3:107747719-107747741 ATGTCTTTGGTAAGGGTACCAGG - Intronic
959827135 3:110811590-110811612 ATGTCGTCAGTTTGGTGACCTGG + Intergenic
960269985 3:115662969-115662991 TTTTATTTAGTTTGGAAACCAGG - Intronic
962165577 3:133044377-133044399 ATATGTTTAGTCTGGGTACCAGG - Intronic
965722297 3:171675429-171675451 ATGGCTTTAGTTTGAATACCCGG + Intronic
967993864 3:195152270-195152292 ATGTGTTTAGTTGGGATAAGGGG - Intronic
968879468 4:3291927-3291949 GTGTGATTAGTTTGGATCCCAGG - Intergenic
969153418 4:5189545-5189567 ATGTCTTTCGGTAGGCTACCAGG - Intronic
970513045 4:16799920-16799942 ATGTTTTTATTTGGGAAACCTGG + Intronic
970528672 4:16959462-16959484 ATGCCTTCATTTTGAATACCAGG - Intergenic
971770612 4:30891467-30891489 ATGTCTATAATTAGGATACCAGG + Intronic
971811532 4:31433997-31434019 ATATGCTTAATTTGGATACCAGG + Intergenic
975530319 4:75393474-75393496 ATGTCTTTATTTTGGTGTCCAGG - Intergenic
975746763 4:77482484-77482506 GTGTTTCTAGTTTGGAGACCAGG - Intergenic
979110964 4:116756065-116756087 GTATCTTTGGTTTGTATACCAGG - Intergenic
980191541 4:129530928-129530950 ATTTATTTATTTTGGATAGCAGG + Intergenic
980725738 4:136758137-136758159 ATGTCTTTTGTGTGGCTTCCAGG + Intergenic
981660012 4:147156033-147156055 ATGTTTTCATTTTGGATAACTGG + Intergenic
982549033 4:156773954-156773976 ATGTTTTTAGTATGGAGCCCAGG - Intronic
984619846 4:181939922-181939944 AAGTCTTTATTATGGAGACCAGG - Intergenic
985313415 4:188629010-188629032 ATGTTGTTAGTTTGCATGCCTGG - Intergenic
986617865 5:9638695-9638717 ATGTCTTGAGTTTGGCTACCAGG + Intronic
986800178 5:11251441-11251463 ATGTCATCACTTTGCATACCAGG - Intronic
986884918 5:12222115-12222137 ATGTCTTTGGTTTTGTTATCAGG + Intergenic
987612142 5:20219492-20219514 ATGTCTTTAGTTTTAGTATCAGG - Intronic
987996032 5:25280771-25280793 ATGTGTTTGGTTTTGATACCAGG - Intergenic
988041372 5:25892528-25892550 ATCCCTATAATTTGGATACCAGG - Intergenic
988607698 5:32694187-32694209 ATATCTGAAGTTGGGATACCAGG + Intronic
992437823 5:76772413-76772435 CTGCCTTTACTTTTGATACCTGG - Intergenic
993553067 5:89299506-89299528 ATGTCTTTAGTTTGTAGAAATGG + Intergenic
994410549 5:99402707-99402729 ATGTATACAGTTTGGATCCCAGG + Intergenic
994483277 5:100362562-100362584 ATGTATACAGTTTGGATCCCAGG - Intergenic
995649396 5:114351906-114351928 ATGTCTTTCATTTTGATATCAGG + Intergenic
996494574 5:124138978-124139000 ATGTACTTAGTTTGGATCCTAGG - Intergenic
996896792 5:128493883-128493905 AGGTTTTTAGCTTGGATAACTGG + Intronic
1006082975 6:31578040-31578062 ATGTATTTATTTGGGAGACCGGG + Exonic
1006260601 6:32866051-32866073 ATGTCTTGAGTTTGGATTAAAGG - Intergenic
1007883068 6:45188652-45188674 ATATCTTTAGTTTGTAGACATGG - Intronic
1008727226 6:54436995-54437017 GTGTCTTTGGTTTTGGTACCAGG + Intergenic
1009747972 6:67844585-67844607 GTGTCTTTAGTTTTGGTATCAGG - Intergenic
1009993360 6:70871242-70871264 ATGTCTTTGGTTTTGGTATCAGG + Intronic
1011851318 6:91632690-91632712 ATGTCTTGAGTCTGGATCCTAGG - Intergenic
1012100030 6:95071909-95071931 CTGTCTTTAGTTTTGATATCAGG + Intergenic
1012478589 6:99641945-99641967 ATGTCTTAAATTTTTATACCTGG + Intergenic
1013534121 6:111047748-111047770 GTGTCTTTGGTTTGGGTATCAGG + Intergenic
1016013318 6:139160444-139160466 CTGTTTTTAGTTTGGAGACAAGG + Intronic
1020214203 7:6177137-6177159 GTGTCTTTGGTTTGGGTATCAGG + Intronic
1020659921 7:10970169-10970191 ATATCTTGAATTTGAATACCTGG + Intergenic
1020889785 7:13864635-13864657 AGATCTTTATTTTGGATGCCTGG - Intergenic
1021653355 7:22852769-22852791 ATGTATTTAATGTGTATACCCGG + Intergenic
1021762850 7:23918169-23918191 ATGTTTTTAGCTTGAATAACTGG - Intergenic
1022382227 7:29871181-29871203 ATGTCTCTCTTTTGGATTCCAGG + Intronic
1023716508 7:43049698-43049720 GTGTCTTTAGTTTTGATATCAGG - Intergenic
1024131165 7:46354467-46354489 CTCTCTTTAGTGTGGATACCTGG - Intergenic
1024369808 7:48568583-48568605 ATGTCTTTAGTTGTGGTATCAGG + Intronic
1024496217 7:50049331-50049353 ATGTCTTTGGTTTAGGTATCAGG - Intronic
1026209340 7:68289579-68289601 ATTTCTTTTGTATGGATCCCAGG + Intergenic
1026633785 7:72063002-72063024 ATGTCTTTGGTTTTGGTATCAGG - Intronic
1026682588 7:72478735-72478757 TTGACTTTATTTTGGGTACCCGG - Intergenic
1027674943 7:81145520-81145542 GTGTCTTTGGTTTTGATAGCAGG - Intergenic
1028810016 7:95075397-95075419 ATGTCTTTAGTTTGATTCCTGGG - Intronic
1029925491 7:104311785-104311807 AGGTCTTCAGTTTGGCTGCCTGG - Intergenic
1030370142 7:108690270-108690292 ATGTCTTTGGTTTTGATATCAGG + Intergenic
1034288412 7:149907122-149907144 CTGTTTTTATTTTGCATACCAGG - Intergenic
1034662720 7:152785858-152785880 CTGTTTTTATTTTGCATACCAGG + Intronic
1037255801 8:16951746-16951768 GTGTCTTTGGTTTTGATATCAGG - Intergenic
1040775674 8:51040288-51040310 ATATCTTTATTTTAGAGACCTGG + Intergenic
1040989586 8:53335684-53335706 ATGTTTTGTGTTTGGCTACCAGG + Intergenic
1042353063 8:67797563-67797585 AATTCTTTAGTTTTGATACTCGG + Intergenic
1043504928 8:80893249-80893271 ATGTCTATCCTTTGCATACCAGG - Intergenic
1044496212 8:92887021-92887043 ATTTTTATAGTTTGGATATCAGG + Intronic
1045991120 8:108309662-108309684 ATGTCTTTGGTTTTGGTATCAGG - Intronic
1046214250 8:111121682-111121704 ATCTATTTATTTTGGAGACCAGG - Intergenic
1046589810 8:116192632-116192654 ATGGGTTTAGTTTTGATCCCTGG - Intergenic
1048664196 8:136642723-136642745 ATTTCTTTATTTTGGATAGATGG + Intergenic
1048901732 8:139044444-139044466 CTGTCTCTAGTAAGGATACCAGG + Intergenic
1053047287 9:34930448-34930470 CTGTCTTTATTTAGGACACCAGG - Intergenic
1053397988 9:37791915-37791937 ATGTCTTTAGTTTTGATATCAGG - Intronic
1054916531 9:70499759-70499781 ATGTCTTTAGTCTGGATTCAGGG - Intergenic
1054955711 9:70907556-70907578 ATGTCTTTATTTTAGATTCAAGG + Intronic
1055285297 9:74722565-74722587 ATGTCTTTAGTTTGGCAATTGGG + Exonic
1055817509 9:80224215-80224237 ATGTTTTTAGTTTACATATCTGG + Intergenic
1056212530 9:84378365-84378387 ATGTCTTTGGTTTTGATATTAGG + Intergenic
1057278278 9:93688311-93688333 ATGTCTATAATTTTGATACCAGG - Intergenic
1059045857 9:110865540-110865562 ATATCTTTGGTTTGGGTACAGGG + Intergenic
1059144001 9:111881183-111881205 ATGTCTTCAGTTTTGGTATCAGG - Intergenic
1059317081 9:113435069-113435091 ATGTCTTTAGTTTTGGTATGAGG + Intergenic
1061228413 9:129295309-129295331 CTGTTTTTGGTTTTGATACCAGG + Intergenic
1061545351 9:131301304-131301326 AGGTCTTTAGGTTGAAAACCAGG - Intronic
1186001220 X:5013327-5013349 ATTCCTTTCCTTTGGATACCAGG - Intergenic
1186983282 X:14982158-14982180 ATGTCTTTGGTTTCGGTATCAGG - Intergenic
1188668195 X:32851142-32851164 ATGTCTTTTGCCTGGAAACCAGG - Intronic
1188973240 X:36642378-36642400 AGTTCTTTAGTTTGCATTCCTGG + Intergenic
1189075389 X:37908957-37908979 ATGTCTTTAATTTGGATCCTAGG + Intronic
1190503740 X:51104567-51104589 ACGTCTTTACATTGAATACCTGG - Intergenic
1190768419 X:53495008-53495030 ATGTCTTTGGTTTTGATATCAGG - Intergenic
1192353727 X:70379895-70379917 ATGTCTTTGGTTTTGGTATCAGG - Intronic
1192562567 X:72137073-72137095 GTGTCTTTATTTTGGCTACAGGG + Intronic
1193584200 X:83300561-83300583 ATGTCTTTCTTTTTGAGACCAGG - Intergenic
1193631007 X:83888541-83888563 ATGTCTTTGCTTTTGATTCCTGG - Intergenic
1193732577 X:85118482-85118504 ATGTCTTGAGTTTCCATCCCAGG - Intergenic
1193843296 X:86436614-86436636 ATGTCTTTAGTTTTGGTATCAGG + Intronic
1194480807 X:94421248-94421270 GTGTCTTTAGTTTTGGTATCAGG + Intergenic
1195370757 X:104169866-104169888 ATGACTTTAATTTGAATACTGGG - Intronic
1195640202 X:107165492-107165514 ATGTCTCTAGTTTTGATATCAGG - Intronic
1195837944 X:109140487-109140509 ATGTCTTTGGTTTTGGTATCAGG - Intergenic
1196260983 X:113581355-113581377 ATGTCTTGAGTCTTGGTACCAGG + Intergenic
1196412118 X:115431268-115431290 AGTTCTTCAGTTTGGATAACAGG + Intergenic
1198446352 X:136720159-136720181 ATGTCTTTGGTTTGGGTATTGGG - Intronic
1199197615 X:145049481-145049503 ATGTCTTTGGTTTTGCTATCAGG - Intergenic
1199645966 X:149912126-149912148 GTGTCTTTGGTTTGGGTATCAGG - Intergenic
1200379829 X:155823890-155823912 GTGTCTTTAGTTTTGGTATCAGG - Intergenic
1200387595 X:155908611-155908633 ATGTCTTTGGTTTTGATACCAGG + Intronic
1201592048 Y:15626290-15626312 CTATCTTTAGGTTGGATTCCTGG + Intergenic