ID: 1150405199

View in Genome Browser
Species Human (GRCh38)
Location 17:64895465-64895487
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 11, 1: 4, 2: 2, 3: 12, 4: 158}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150405193_1150405199 24 Left 1150405193 17:64895418-64895440 CCAGGTCCAAAAGTTGAACTGTA 0: 5
1: 2
2: 14
3: 23
4: 98
Right 1150405199 17:64895465-64895487 GCTTGATCCTGACCTGGTGTTGG 0: 11
1: 4
2: 2
3: 12
4: 158
1150405192_1150405199 25 Left 1150405192 17:64895417-64895439 CCCAGGTCCAAAAGTTGAACTGT 0: 5
1: 11
2: 12
3: 18
4: 125
Right 1150405199 17:64895465-64895487 GCTTGATCCTGACCTGGTGTTGG 0: 11
1: 4
2: 2
3: 12
4: 158
1150405194_1150405199 18 Left 1150405194 17:64895424-64895446 CCAAAAGTTGAACTGTAACGCTG 0: 5
1: 0
2: 4
3: 8
4: 66
Right 1150405199 17:64895465-64895487 GCTTGATCCTGACCTGGTGTTGG 0: 11
1: 4
2: 2
3: 12
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900316528 1:2059952-2059974 GCTGGCCCCTGAGCTGGTGTGGG + Intronic
900362277 1:2294834-2294856 GGTGGATCCTGCCCTGCTGTGGG - Intronic
902575713 1:17375939-17375961 GCTTGTTCCTGAGCTGATGGGGG - Intronic
904624831 1:31796562-31796584 GTTGGAGCCTGACCTGGTGCTGG - Intronic
904798556 1:33076124-33076146 GTTTGCTCTTGGCCTGGTGTTGG + Intronic
906495915 1:46303700-46303722 TCTTGATCCTGAACTGGGTTAGG + Exonic
906796938 1:48704627-48704649 TGTTGATCCTGACCTTGCGTGGG - Intronic
907797150 1:57729180-57729202 GTTTGGTCCTGCCCTGGTGTGGG + Intronic
908806072 1:67934132-67934154 TGATGATCCTGACCTTGTGTAGG + Intergenic
909782857 1:79569421-79569443 TAATGATCCTGACCTTGTGTAGG - Intergenic
911661086 1:100501812-100501834 TGATTATCCTGACCTGGTGTAGG + Intronic
916557999 1:165909696-165909718 GATTGATCCTGAACTGATCTTGG - Intronic
918063993 1:181087400-181087422 GCCTGATCCTGCCCCGGGGTTGG - Intergenic
921607964 1:217177379-217177401 GCATGGTCCTGTCCTGGTGAGGG - Intergenic
922313560 1:224420313-224420335 GTGTGACCCTGACCTGGTTTTGG + Intronic
1065589280 10:27249676-27249698 GCCTGATCCTGACCTGGTGTTGG + Intergenic
1067124353 10:43503195-43503217 TGATGATCCTGACCTTGTGTAGG + Intergenic
1067709124 10:48634721-48634743 GCTTCATCATGAACTGGAGTCGG - Intronic
1069051210 10:63796518-63796540 TATTGATCCTGACCCTGTGTAGG + Intergenic
1070830900 10:79417556-79417578 GCCTGATCCTAACCAGCTGTGGG + Intronic
1071461242 10:85898637-85898659 TGTTGATCCTGACCCTGTGTAGG - Intronic
1074729447 10:116353659-116353681 TGATGATCCTGACCTTGTGTAGG + Intronic
1076562377 10:131375556-131375578 GCATCGTCCTGACCTGGGGTGGG + Intergenic
1078281876 11:9910625-9910647 GGATGATCCTGACCCTGTGTAGG + Intronic
1078901827 11:15649831-15649853 GCTTGAACTGGACCTGATGTAGG - Intergenic
1081508770 11:43746431-43746453 TGAGGATCCTGACCTGGTGTAGG - Intronic
1082682450 11:56192685-56192707 TGATGATCCTGACCTTGTGTGGG + Intergenic
1083625984 11:64072200-64072222 GCTTCATCCTCAGCTGCTGTGGG + Intronic
1086013159 11:82130724-82130746 GTTTGAGCCTGATCTTGTGTTGG + Intergenic
1093770669 12:23014003-23014025 GCTGCATCCTGACATGGTGAAGG + Intergenic
1094737198 12:33248503-33248525 TCTTGATCCTGACCCTGTGTTGG - Intergenic
1097422493 12:59397481-59397503 TGGTGATCCTGACCTGGTGTGGG + Intergenic
1102619672 12:114183990-114184012 CCTTGATCCTGATTTGGTGGGGG - Intergenic
1103668374 12:122590624-122590646 GGTAGATCTTGACCTGGCGTTGG + Exonic
1104085061 12:125466827-125466849 GCTTAGTCTGGACCTGGTGTTGG + Intronic
1104351650 12:128049247-128049269 CTTTGAACCTGACCTGGTCTTGG - Intergenic
1104457609 12:128928400-128928422 GTTTGGTCCTGATCTGGTGAGGG - Intronic
1106065508 13:26344403-26344425 TCATGATCCTGACCCTGTGTAGG - Intronic
1108626939 13:52239011-52239033 GCTTGATACTGGTCTGGTGAGGG - Intergenic
1108659128 13:52567448-52567470 GCTTGATACTGGTCTGGTGAGGG + Intergenic
1109591889 13:64495370-64495392 TGATGATCCTGACCTTGTGTAGG + Intergenic
1110734184 13:78915624-78915646 TGATGATCCTGACCTTGTGTAGG + Intergenic
1111298562 13:86316553-86316575 GCCTGATCATCACCTGGTGATGG - Intergenic
1115676808 14:35685306-35685328 GCTAGAGCCTGACCTATTGTTGG + Intronic
1116843778 14:49845692-49845714 TCTTGATCCTGACTCTGTGTAGG - Intronic
1119328834 14:73778745-73778767 GGTTGACCCAGCCCTGGTGTGGG - Intronic
1120985455 14:90330962-90330984 GCTGCATCCTGCCCTGGGGTGGG - Intronic
1122197949 14:100103620-100103642 GCCTCATCCTCACCTGGGGTGGG - Intronic
1124665890 15:31592415-31592437 GGATGATCCTGACCCTGTGTGGG - Intronic
1126274264 15:46857900-46857922 GCTTGTCCCTGACCTGGACTGGG - Intergenic
1126440259 15:48680664-48680686 TGATGATCCTGACCTTGTGTAGG - Intergenic
1128008096 15:64264547-64264569 GTTTTATCCTGGCCTGGTTTTGG - Intronic
1128959481 15:71986553-71986575 TCTTGATCCTGACCCTGTGTAGG + Intronic
1130664800 15:85860727-85860749 GCCTGATGCAGACCTGGGGTGGG - Intergenic
1134902740 16:17953340-17953362 GCTATATCCTCACCTGGTGGAGG + Intergenic
1138391187 16:56670820-56670842 GCTTGAGCCAGGCCTGCTGTTGG + Intronic
1138656679 16:58495588-58495610 GCCTGGGCCTGACCTGGTTTTGG + Intronic
1141321930 16:83019324-83019346 TCATGATTCTGACCTTGTGTAGG - Intronic
1142989479 17:3720663-3720685 GCTTGAACCTGACGGGGTGGAGG - Intronic
1145870523 17:28269735-28269757 GCTTGATCCTGCCCTTGTGTTGG + Intergenic
1145961973 17:28892156-28892178 ACTTGATCCTGAGATGGTTTGGG - Intronic
1146223623 17:31047952-31047974 GCTTGATCCTGACCTGGTGTTGG + Intergenic
1146223647 17:31048144-31048166 GCTGGATCCTGGCCTAGTGTTGG + Intergenic
1146811695 17:35909047-35909069 GCTTGATCTTGGCTTGGTGTTGG + Intergenic
1146811745 17:35909426-35909448 GCTTGATCCTGACCCGGTGTTGG + Intergenic
1146811774 17:35909618-35909640 GCTTGATCCTGACCTTGTGTTGG + Intergenic
1146812239 17:35913282-35913304 GCTTGATCCTGGCCTTCTGTTGG + Intergenic
1146812315 17:35913843-35913865 GCTTGATCCTGATCTTGTATTGG + Intergenic
1147232730 17:39030860-39030882 GCTTGGTCCTGGCCTGCTATTGG - Intergenic
1147232781 17:39031212-39031234 GCTTGATCCTGACCTGGTGTTGG - Intergenic
1147232814 17:39031404-39031426 GCTTGATCCTGACCTGGTGTTGG - Intergenic
1147232866 17:39031764-39031786 GCTTGATCCTGGCCTCGTGTTGG - Intergenic
1147922003 17:43923426-43923448 GCTTGATCCTGACCTGGTGTTGG + Intergenic
1147922028 17:43923618-43923640 GCTTGATCCTGACCTTGTGTTGG + Intergenic
1148008654 17:44456197-44456219 GCTTGAGCCCTACCTAGTGTTGG - Intronic
1148173985 17:45548543-45548565 GCTTGATCCTGACCTGGTGTTGG + Intergenic
1148275282 17:46296904-46296926 GCTTGATCCTGACCTGGTGTTGG - Exonic
1148297388 17:46514483-46514505 GCTTGATCCTGACCTGGTGTTGG - Exonic
1148361942 17:47018963-47018985 GCTTGATCCTGACCTGGTGTTGG - Intronic
1148738398 17:49878102-49878124 GCTGGATCCTGGCCTAGAGTGGG + Intergenic
1150405199 17:64895465-64895487 GCTTGATCCTGACCTGGTGTTGG + Exonic
1150784229 17:68150071-68150093 GCTTGATCCTGACCTGGTGTTGG + Intergenic
1150784285 17:68150428-68150450 GCTTGATCCTGACCTGGTGTTGG + Intergenic
1152056246 17:78029848-78029870 TGATGATCCTGACCTCGTGTAGG - Intronic
1158148981 18:54344841-54344863 GCTTTATCCTGAATGGGTGTTGG - Intronic
1162866273 19:13549833-13549855 GCTAGATCTAGACCTGGGGTTGG - Intronic
1163796090 19:19338856-19338878 GCTTGAGAAGGACCTGGTGTCGG + Exonic
925740644 2:7002927-7002949 GGATGATCCTGACCCTGTGTAGG + Intronic
926707335 2:15846065-15846087 GCTGGGTCCTGACCAGGCGTTGG - Intergenic
930761975 2:55048552-55048574 TCTTGATCTTGACCCTGTGTAGG - Intronic
931193300 2:60026345-60026367 GCATGATCTTGACCTTGTGTAGG - Intergenic
931778579 2:65560776-65560798 GCTTGAACCTGGCCAGGTGGAGG + Intergenic
937316389 2:120934459-120934481 TCTTGATCCTGAGCTGTAGTTGG + Intronic
938079364 2:128361394-128361416 GCTGGGTCCTGACCTGATGATGG + Intergenic
943179919 2:184528811-184528833 GCTGACTCCTGACATGGTGTAGG + Intergenic
943217327 2:185055170-185055192 TGGTGATCCTGACCTTGTGTAGG + Intergenic
946143154 2:217708928-217708950 GCTTAGCCCTCACCTGGTGTAGG + Intronic
946162781 2:217846334-217846356 GCTGGCTCAGGACCTGGTGTGGG - Intronic
947855113 2:233318764-233318786 GGTTGATCCTGATCTTGTGAAGG + Exonic
948634037 2:239322743-239322765 TCTTCATCCTGCCCGGGTGTGGG + Intronic
948916620 2:241037629-241037651 CCCTGATCCTGGCCTGGTTTGGG - Intronic
1168792369 20:588001-588023 TGATGATCCTGACCTTGTGTAGG - Intergenic
1168798249 20:626657-626679 GCGTGATCCTGGCCTGGAGGAGG - Intergenic
1170615010 20:17941381-17941403 GTTTGCTCCTGACCTGATGGAGG - Intergenic
1172579720 20:36037188-36037210 TCTTGATCCTGACTTTCTGTTGG - Intergenic
1179252218 21:39680748-39680770 GGATGATTCTGACCTTGTGTAGG + Intergenic
1179719804 21:43308583-43308605 GCTTGGTGCTGCCCTGGTGAAGG + Intergenic
1182979915 22:34659265-34659287 GGATGATCCTGACCTTGTGGAGG - Intergenic
1184824397 22:46937772-46937794 GAATGATCCTGACCCTGTGTAGG + Intronic
1185330170 22:50248869-50248891 GTTTGACCCTGAGCTGGTGCTGG - Exonic
950520249 3:13493835-13493857 GATTGGACCTGACCTGGTGCAGG - Intronic
954150031 3:48652691-48652713 GCTTGATTTTGACCGGGGGTGGG + Intronic
954881170 3:53836817-53836839 TCTAGATCCAGACCTGGTGATGG + Intronic
955609929 3:60746172-60746194 GCTTGAAGCTGACATGGTCTCGG + Intronic
958168035 3:89902418-89902440 GAGTGATCCTGACCCTGTGTGGG - Intergenic
959168845 3:102819071-102819093 GCTTTATCATGAATTGGTGTTGG + Intergenic
959967192 3:112369746-112369768 TGATGATCCTGACCTTGTGTAGG + Intergenic
960135930 3:114104970-114104992 GGATGATCCTGACCCTGTGTAGG + Intergenic
960458819 3:117907461-117907483 GGATGATCCTGACCCTGTGTAGG + Intergenic
961259808 3:125593168-125593190 GCTTCGTCCTGACCTGCTATGGG - Intronic
961529654 3:127532786-127532808 CCTTGAACCTGACCTGGCCTTGG + Intergenic
964368986 3:155979774-155979796 GAATGATCCTGACCCTGTGTAGG - Intergenic
964911920 3:161793323-161793345 GCTTTATCCTCACCTTCTGTTGG + Intergenic
965796953 3:172449339-172449361 GCTTGATGCAAACCTGGTGGCGG + Intergenic
969130893 4:4990501-4990523 GCTGGATCCAGGCTTGGTGTAGG + Intergenic
972524678 4:39896838-39896860 TGGTGATCCTGACCTGGCGTAGG - Intronic
974303323 4:60098419-60098441 GCTTGATGCTGCCATGGGGTTGG + Intergenic
975617649 4:76263727-76263749 GCTTGATCCTGACCGGAAGCTGG + Exonic
976038137 4:80849235-80849257 TGATGATCCTGACCCGGTGTAGG - Intronic
976481668 4:85553840-85553862 ATTTGATCCTGTCATGGTGTTGG + Intronic
977661520 4:99592592-99592614 TGATGATCCTGACCTTGTGTAGG - Intronic
987484410 5:18506367-18506389 CGATGATCCTGACCTTGTGTAGG + Intergenic
994585234 5:101699600-101699622 TGATGATCCTGACCTTGTGTAGG + Intergenic
997387314 5:133483612-133483634 GCTGGATCATGACCTGGCCTTGG - Intronic
998541376 5:142985073-142985095 GGATGATCCTGACCCTGTGTAGG + Intronic
1000769760 5:165338212-165338234 GGATGATCCTGACCCTGTGTAGG + Intergenic
1003235337 6:4290357-4290379 GGATGATTCTGACCTTGTGTGGG + Intergenic
1003826613 6:9959839-9959861 GCTTGGTGCTGTCCTGGTGATGG - Intronic
1006729857 6:36228796-36228818 GCCTGATACTCCCCTGGTGTGGG + Intronic
1008467583 6:51847822-51847844 CCTTGGTTCTGACCTGGTGATGG + Exonic
1011885935 6:92095714-92095736 GGATGATCCTGACCCTGTGTAGG + Intergenic
1012357571 6:98334729-98334751 AGATGATCCTGACCTGGTTTGGG + Intergenic
1015043727 6:128753731-128753753 CATTGATCCTGACCCTGTGTAGG + Intergenic
1015650867 6:135457609-135457631 GCTTGATGATGACCTTGTCTTGG - Exonic
1016592303 6:145759996-145760018 TCATGATCCTGACCCTGTGTAGG + Intergenic
1017655893 6:156629316-156629338 GGATGATCCTGACCCTGTGTAGG + Intergenic
1017833181 6:158151178-158151200 GGATGATCCTGACCCTGTGTAGG + Intronic
1017863006 6:158416388-158416410 GAATGATCCTGACCGGGTGTAGG + Intronic
1018527777 6:164733136-164733158 GGATGATCCTGACCCTGTGTAGG + Intergenic
1019774698 7:2905698-2905720 GCTTGCTCCTGACCTGCAGGAGG + Intergenic
1024345380 7:48308184-48308206 TCATGATCCTGACCTCATGTAGG - Intronic
1024598744 7:50961645-50961667 GCTGGAGCCTGACCAGGTGGTGG + Intergenic
1025613526 7:63098463-63098485 GGATGATCCTGACCCTGTGTAGG - Intergenic
1026033607 7:66815819-66815841 CCATGACCCTGACCTGGTTTGGG - Intergenic
1029796034 7:102895528-102895550 GCTTGAACCTGAGCTTGAGTGGG + Intronic
1032158870 7:129494911-129494933 TCATGATCCTGACCCTGTGTAGG - Intergenic
1032394009 7:131576005-131576027 GGTTGATTGTGCCCTGGTGTGGG + Intergenic
1034279224 7:149840113-149840135 TCATGATCCTGACCCTGTGTAGG + Intronic
1034373198 7:150618971-150618993 TCATGATCCTGACCATGTGTAGG - Intergenic
1035645204 8:1213815-1213837 GCTGCCTCCTGACCTGGTCTGGG + Intergenic
1038023719 8:23571250-23571272 GCTTCATTCCGACCTGGGGTGGG + Intronic
1039715606 8:40105199-40105221 TGATGATCCTGACCTTGTGTAGG - Intergenic
1042237996 8:66634860-66634882 GCTTGATCCTGATTTGGTTGAGG - Exonic
1043799645 8:84591734-84591756 ACTTGAGCCAGACCTGGTGTAGG + Intronic
1045490835 8:102667769-102667791 TCTTCATCATGACCTGGTGGTGG - Intergenic
1049141270 8:140956698-140956720 TGATGATCCTGACCTTGTGTGGG + Intronic
1050753601 9:8971928-8971950 GCTTGATTCAAATCTGGTGTAGG - Intronic
1051316828 9:15845025-15845047 GCTTTATCCATAACTGGTGTTGG + Intronic
1052652739 9:31324660-31324682 TATTGATCCTGACCCTGTGTAGG + Intergenic
1052819670 9:33128838-33128860 AGTTGATCTTGACCTTGTGTAGG + Intronic
1053493697 9:38532887-38532909 GCTTGTTCCCTACCTGGTGCAGG + Intergenic
1055464867 9:76554788-76554810 GGATGATCCTGACCTTGTGTAGG - Intergenic
1059028551 9:110664498-110664520 TTTTGATCCTGACCCTGTGTAGG - Intergenic
1059174084 9:112153331-112153353 ACATGATCCTGACCATGTGTAGG - Intronic
1061494160 9:130962216-130962238 GCTTCATCTTGGCCTGGTGAAGG - Intergenic
1062479287 9:136744031-136744053 GCTTTATTCTGAGCTGGTGCTGG + Exonic
1188442478 X:30226289-30226311 TGATGATCCTGACCTTGTGTAGG + Intergenic
1189099469 X:38173888-38173910 GCTGGATCCTGAAGAGGTGTTGG - Intronic
1190116405 X:47628520-47628542 GCTTACTGCGGACCTGGTGTTGG - Intronic
1192496943 X:71622547-71622569 GCCTGATTCTGTCCTGGTCTGGG - Intergenic
1194072959 X:89350498-89350520 GCAGGTTCCTGACCTGGAGTGGG - Intergenic
1195058426 X:101169789-101169811 TGATGATCCTGCCCTGGTGTAGG + Intergenic
1198064800 X:133085472-133085494 GCTTGATGCAGACCAGTTGTAGG - Intronic
1198180800 X:134206718-134206740 TGGTGATCCTGACCCGGTGTAGG + Intergenic
1200619771 Y:5428416-5428438 TGATGATCCTGACCAGGTGTAGG - Intronic
1200727198 Y:6686238-6686260 GCAGGTTCCTGACCTGGAGTGGG - Intergenic
1200728350 Y:6702013-6702035 GCAGGTTCCTGACCTGGAGTGGG - Intergenic