ID: 1150413242

View in Genome Browser
Species Human (GRCh38)
Location 17:64964638-64964660
Sequence GAGGACCACTTGACTATGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150413229_1150413242 30 Left 1150413229 17:64964585-64964607 CCGGGCATGGTGGTGCACACCTG 0: 1870
1: 7031
2: 30417
3: 78542
4: 159160
Right 1150413242 17:64964638-64964660 GAGGACCACTTGACTATGGGAGG No data
1150413232_1150413242 11 Left 1150413232 17:64964604-64964626 CCTGTAATCCCAGCTACTTGGGA 0: 48553
1: 142115
2: 242012
3: 520212
4: 384467
Right 1150413242 17:64964638-64964660 GAGGACCACTTGACTATGGGAGG No data
1150413236_1150413242 2 Left 1150413236 17:64964613-64964635 CCAGCTACTTGGGAGGCTGAGGT 0: 12355
1: 109844
2: 220687
3: 278513
4: 285771
Right 1150413242 17:64964638-64964660 GAGGACCACTTGACTATGGGAGG No data
1150413234_1150413242 3 Left 1150413234 17:64964612-64964634 CCCAGCTACTTGGGAGGCTGAGG 0: 92836
1: 203589
2: 246027
3: 262461
4: 302975
Right 1150413242 17:64964638-64964660 GAGGACCACTTGACTATGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150413242 Original CRISPR GAGGACCACTTGACTATGGG AGG Intergenic
No off target data available for this crispr