ID: 1150414752

View in Genome Browser
Species Human (GRCh38)
Location 17:64977682-64977704
Sequence GAGGGTAAAGACTCTCATAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150414746_1150414752 19 Left 1150414746 17:64977640-64977662 CCTATTTCTTACATGTCACCCTT No data
Right 1150414752 17:64977682-64977704 GAGGGTAAAGACTCTCATACGGG No data
1150414748_1150414752 0 Left 1150414748 17:64977659-64977681 CCTTACTCAACTGCGAGATGCTT No data
Right 1150414752 17:64977682-64977704 GAGGGTAAAGACTCTCATACGGG No data
1150414747_1150414752 1 Left 1150414747 17:64977658-64977680 CCCTTACTCAACTGCGAGATGCT No data
Right 1150414752 17:64977682-64977704 GAGGGTAAAGACTCTCATACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150414752 Original CRISPR GAGGGTAAAGACTCTCATAC GGG Intergenic
No off target data available for this crispr