ID: 1150416553

View in Genome Browser
Species Human (GRCh38)
Location 17:64993478-64993500
Sequence CGTGTGCCCCTTGGCACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150416553_1150416564 20 Left 1150416553 17:64993478-64993500 CCAGCTGTGCCAAGGGGCACACG No data
Right 1150416564 17:64993521-64993543 TGCTGGATGAAGAACAGGGCAGG No data
1150416553_1150416562 15 Left 1150416553 17:64993478-64993500 CCAGCTGTGCCAAGGGGCACACG No data
Right 1150416562 17:64993516-64993538 CAGGGTGCTGGATGAAGAACAGG No data
1150416553_1150416565 23 Left 1150416553 17:64993478-64993500 CCAGCTGTGCCAAGGGGCACACG No data
Right 1150416565 17:64993524-64993546 TGGATGAAGAACAGGGCAGGAGG No data
1150416553_1150416560 -3 Left 1150416553 17:64993478-64993500 CCAGCTGTGCCAAGGGGCACACG No data
Right 1150416560 17:64993498-64993520 ACGTGGAGGGGCTCACTTCAGGG No data
1150416553_1150416561 3 Left 1150416553 17:64993478-64993500 CCAGCTGTGCCAAGGGGCACACG No data
Right 1150416561 17:64993504-64993526 AGGGGCTCACTTCAGGGTGCTGG No data
1150416553_1150416559 -4 Left 1150416553 17:64993478-64993500 CCAGCTGTGCCAAGGGGCACACG No data
Right 1150416559 17:64993497-64993519 CACGTGGAGGGGCTCACTTCAGG No data
1150416553_1150416563 16 Left 1150416553 17:64993478-64993500 CCAGCTGTGCCAAGGGGCACACG No data
Right 1150416563 17:64993517-64993539 AGGGTGCTGGATGAAGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150416553 Original CRISPR CGTGTGCCCCTTGGCACAGC TGG (reversed) Intergenic