ID: 1150416558

View in Genome Browser
Species Human (GRCh38)
Location 17:64993487-64993509
Sequence GCCCCTCCACGTGTGCCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150416558_1150416561 -6 Left 1150416558 17:64993487-64993509 CCAAGGGGCACACGTGGAGGGGC No data
Right 1150416561 17:64993504-64993526 AGGGGCTCACTTCAGGGTGCTGG No data
1150416558_1150416565 14 Left 1150416558 17:64993487-64993509 CCAAGGGGCACACGTGGAGGGGC No data
Right 1150416565 17:64993524-64993546 TGGATGAAGAACAGGGCAGGAGG No data
1150416558_1150416564 11 Left 1150416558 17:64993487-64993509 CCAAGGGGCACACGTGGAGGGGC No data
Right 1150416564 17:64993521-64993543 TGCTGGATGAAGAACAGGGCAGG No data
1150416558_1150416563 7 Left 1150416558 17:64993487-64993509 CCAAGGGGCACACGTGGAGGGGC No data
Right 1150416563 17:64993517-64993539 AGGGTGCTGGATGAAGAACAGGG No data
1150416558_1150416562 6 Left 1150416558 17:64993487-64993509 CCAAGGGGCACACGTGGAGGGGC No data
Right 1150416562 17:64993516-64993538 CAGGGTGCTGGATGAAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150416558 Original CRISPR GCCCCTCCACGTGTGCCCCT TGG (reversed) Intergenic