ID: 1150416559

View in Genome Browser
Species Human (GRCh38)
Location 17:64993497-64993519
Sequence CACGTGGAGGGGCTCACTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150416553_1150416559 -4 Left 1150416553 17:64993478-64993500 CCAGCTGTGCCAAGGGGCACACG No data
Right 1150416559 17:64993497-64993519 CACGTGGAGGGGCTCACTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150416559 Original CRISPR CACGTGGAGGGGCTCACTTC AGG Intergenic