ID: 1150416560

View in Genome Browser
Species Human (GRCh38)
Location 17:64993498-64993520
Sequence ACGTGGAGGGGCTCACTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150416553_1150416560 -3 Left 1150416553 17:64993478-64993500 CCAGCTGTGCCAAGGGGCACACG No data
Right 1150416560 17:64993498-64993520 ACGTGGAGGGGCTCACTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150416560 Original CRISPR ACGTGGAGGGGCTCACTTCA GGG Intergenic