ID: 1150416562

View in Genome Browser
Species Human (GRCh38)
Location 17:64993516-64993538
Sequence CAGGGTGCTGGATGAAGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150416558_1150416562 6 Left 1150416558 17:64993487-64993509 CCAAGGGGCACACGTGGAGGGGC No data
Right 1150416562 17:64993516-64993538 CAGGGTGCTGGATGAAGAACAGG No data
1150416553_1150416562 15 Left 1150416553 17:64993478-64993500 CCAGCTGTGCCAAGGGGCACACG No data
Right 1150416562 17:64993516-64993538 CAGGGTGCTGGATGAAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150416562 Original CRISPR CAGGGTGCTGGATGAAGAAC AGG Intergenic