ID: 1150416563

View in Genome Browser
Species Human (GRCh38)
Location 17:64993517-64993539
Sequence AGGGTGCTGGATGAAGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150416553_1150416563 16 Left 1150416553 17:64993478-64993500 CCAGCTGTGCCAAGGGGCACACG No data
Right 1150416563 17:64993517-64993539 AGGGTGCTGGATGAAGAACAGGG No data
1150416558_1150416563 7 Left 1150416558 17:64993487-64993509 CCAAGGGGCACACGTGGAGGGGC No data
Right 1150416563 17:64993517-64993539 AGGGTGCTGGATGAAGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150416563 Original CRISPR AGGGTGCTGGATGAAGAACA GGG Intergenic