ID: 1150420701

View in Genome Browser
Species Human (GRCh38)
Location 17:65032788-65032810
Sequence TCTATGACTTCATTTTTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 517
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 481}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150420697_1150420701 -1 Left 1150420697 17:65032766-65032788 CCTTTTCTGCCCCATGGCTTTCT 0: 1
1: 0
2: 2
3: 48
4: 444
Right 1150420701 17:65032788-65032810 TCTATGACTTCATTTTTCTCTGG 0: 1
1: 0
2: 1
3: 34
4: 481
1150420698_1150420701 -10 Left 1150420698 17:65032775-65032797 CCCCATGGCTTTCTCTATGACTT 0: 1
1: 0
2: 4
3: 32
4: 360
Right 1150420701 17:65032788-65032810 TCTATGACTTCATTTTTCTCTGG 0: 1
1: 0
2: 1
3: 34
4: 481
1150420695_1150420701 30 Left 1150420695 17:65032735-65032757 CCTATTCTATTGGTCTTTATCTT 0: 1
1: 0
2: 1
3: 48
4: 529
Right 1150420701 17:65032788-65032810 TCTATGACTTCATTTTTCTCTGG 0: 1
1: 0
2: 1
3: 34
4: 481

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150420701 Original CRISPR TCTATGACTTCATTTTTCTC TGG Intronic
900362438 1:2295831-2295853 TCTATCCCGTCATTTGTCTCTGG + Intronic
901432864 1:9228159-9228181 TGTATGTTTTCATTTTTCTTGGG - Intergenic
902253031 1:15168279-15168301 TCTATCTCTGCATTTTTCTGTGG + Intronic
902295761 1:15465935-15465957 TCCATCACTTCCTTTTTCTCAGG + Intronic
902298644 1:15485837-15485859 TCCACCACTTCCTTTTTCTCAGG + Intronic
903763594 1:25717142-25717164 TGTATGTGTTCATTTTTCTTAGG + Intronic
904360253 1:29966535-29966557 TCAAAGTCTTTATTTTTCTCAGG - Intergenic
904363435 1:29993553-29993575 TCTATGACTCCTTTTCTCTCAGG - Intergenic
906830453 1:49025755-49025777 ACTATGAATGCAATTTTCTCAGG - Intronic
906870337 1:49472463-49472485 TCTGAGACTTAATTTTTCTGAGG - Intronic
907396016 1:54190429-54190451 TCTCTTACTTCAATTTCCTCTGG + Intronic
908027064 1:59963995-59964017 TCTCTGATTTCATTTTTTTTAGG - Intergenic
908511911 1:64856497-64856519 TCTATGACTGCTGTTTTCCCCGG + Intronic
908583063 1:65538219-65538241 ATTATGACTTCCTTTTTCCCTGG + Intronic
908990682 1:70084639-70084661 TATATGTTTTCATTTTTCTTGGG + Intronic
909209177 1:72800741-72800763 TCCATGACTCCCTTTCTCTCTGG + Intergenic
909251670 1:73365116-73365138 TCAATGACGTCTTTTTACTCTGG + Intergenic
909772915 1:79446986-79447008 TCAGTTTCTTCATTTTTCTCAGG - Intergenic
909837235 1:80271911-80271933 ACTGTGACTTCATCTTTTTCTGG - Intergenic
909998379 1:82309762-82309784 TGTATGTTTTCATTTTTCTTGGG + Intergenic
910350909 1:86296599-86296621 TGTATGATTTAATCTTTCTCTGG - Intergenic
910655415 1:89613557-89613579 TTTATGTCTTCATGTTTCTAAGG - Intergenic
910839027 1:91543747-91543769 TCTGTGTCTTCATTTCTCTTGGG + Intergenic
911211366 1:95141956-95141978 TCAATGACTTGGCTTTTCTCTGG + Intronic
911818929 1:102391403-102391425 CCTATGTGTTCATTTTTCTTGGG - Intergenic
912804651 1:112745528-112745550 TTTATGATTTCATTTCTCTTGGG + Intergenic
913307532 1:117448385-117448407 TCTATGAACAGATTTTTCTCTGG - Intronic
914929032 1:151913259-151913281 TGTATGCCTTCATTTCTCTTGGG + Intergenic
916006992 1:160671464-160671486 TCTATAACCTCATTTTTTACAGG - Intergenic
916443510 1:164850733-164850755 TCCCTGATTTTATTTTTCTCAGG - Exonic
916751701 1:167728834-167728856 TCTATGACTTAAGTTTTGTTAGG + Intronic
916900286 1:169215030-169215052 TGTGTGACTTCATTCTTCTTGGG - Intronic
917242984 1:172969564-172969586 TCTATGTCTTTTTTTTTTTCTGG + Intergenic
917512798 1:175682091-175682113 TGGATGCCTGCATTTTTCTCAGG - Intronic
918651751 1:186973308-186973330 TCTCTGCCTTCATTTTTGTATGG + Intronic
918684066 1:187393252-187393274 TTTAAGGCTTCATTTTTTTCAGG - Intergenic
918966218 1:191352587-191352609 GATATGACTTCATTTTTTTATGG + Intergenic
919272604 1:195369019-195369041 TCTATGTCATCATTTTTATGTGG - Intergenic
919291619 1:195640725-195640747 TATATGATTTCATTTCTCTTGGG - Intergenic
919460300 1:197869328-197869350 TCTATGAGCTGATTTTTCTTTGG - Intergenic
919490821 1:198202971-198202993 TCTACCACTTCTTTTTTTTCAGG + Intronic
920223821 1:204423916-204423938 TCTCTCCCTTCATTTGTCTCTGG - Exonic
920733157 1:208507586-208507608 CCTAAGATTTCATTTTTCTTAGG - Intergenic
921234160 1:213107639-213107661 TATATGTTTTCATTTTTCTTGGG + Intronic
922216146 1:223521854-223521876 TCTAATACTTCATTTTTTCCAGG + Intergenic
922635018 1:227159632-227159654 TTTTTAACTTCATTTTTTTCTGG - Intronic
923885052 1:238145428-238145450 TCTATTCCCTCCTTTTTCTCAGG - Intergenic
924004782 1:239597224-239597246 CCTATACCTTCTTTTTTCTCCGG - Intronic
924093637 1:240527930-240527952 TCTATAATTTCATTTTCCTCTGG - Intronic
1063306412 10:4906001-4906023 TCTATTTCTTCATTTCTGTCTGG + Intergenic
1063351463 10:5360114-5360136 TCTAATATATCATTTTTCTCTGG - Intergenic
1063351962 10:5364338-5364360 TCTACACCTGCATTTTTCTCTGG - Intergenic
1064020688 10:11806172-11806194 GCTTTGACTTCACTTTTTTCAGG - Intergenic
1064639993 10:17405923-17405945 TCTATGATTTCAGCTTCCTCAGG + Intronic
1065452769 10:25875931-25875953 TTTATAACCTCATTTTTCTTAGG - Intergenic
1065601386 10:27372615-27372637 TCTATGAGTTTTCTTTTCTCTGG + Intergenic
1065671698 10:28126640-28126662 TCTATGAGTTCATTACTCTTGGG + Intronic
1066475882 10:35746988-35747010 TATATGACTTCTTTTTTTTGAGG + Intergenic
1067487576 10:46665476-46665498 GCTAAGACTCCATTTTTTTCTGG + Intergenic
1067607230 10:47676531-47676553 GCTAAGACTCCATTTTTTTCTGG - Intergenic
1067858132 10:49815419-49815441 TCTTTGGCTTCCTTTTTTTCTGG - Intergenic
1068095544 10:52486832-52486854 TCTAAGTCCTCATTTTTCTCTGG - Intergenic
1068327836 10:55517998-55518020 TCTCAGCCTTCAGTTTTCTCAGG - Intronic
1069481493 10:68786665-68786687 TCTTGGACTACATCTTTCTCGGG + Exonic
1071227628 10:83549045-83549067 TGTATGTTTTCATTTATCTCAGG + Intergenic
1071622786 10:87137911-87137933 GCTAAGACTCCATTTTTTTCTGG - Intronic
1071971773 10:90915344-90915366 TCTATGACTTCCCTCATCTCTGG + Intronic
1073703005 10:105951488-105951510 TTTATGACTTTCTCTTTCTCTGG - Intergenic
1074521908 10:114233684-114233706 ACAATGACTTAATTTCTCTCTGG - Intergenic
1075225778 10:120628023-120628045 TCTCTGACTTCCTTTGTGTCTGG - Intergenic
1075579449 10:123606043-123606065 CCTATGCCTGCATTTTTCACAGG - Intergenic
1076028081 10:127133516-127133538 TTTATAAGTTCATTTTTCTTTGG + Intronic
1076505344 10:130969065-130969087 CATATGTCTTCATTTTTCTTGGG - Intergenic
1077935751 11:6783887-6783909 TCTATGTTTTCATATTTCACTGG - Intergenic
1078078742 11:8186698-8186720 TCTATGTTTTGATTTCTCTCTGG + Intergenic
1078163105 11:8858988-8859010 TCTCTGTCTTCACTTTTCTTAGG - Intronic
1078772285 11:14361752-14361774 TATATGTCTTCATTTCTCTCAGG - Intronic
1079000238 11:16747652-16747674 TCAATTATTTCATTTTTGTCAGG + Intronic
1079814741 11:25041413-25041435 TCTATGATTTCATTTACCTGAGG - Intronic
1080771681 11:35347903-35347925 TCTTTGTCCTCATTTTTCTTAGG - Intronic
1081720291 11:45284079-45284101 TCTGCCCCTTCATTTTTCTCTGG - Intronic
1081749190 11:45495885-45495907 CATATGTTTTCATTTTTCTCTGG + Intergenic
1081974383 11:47222769-47222791 TATATGTTTTCATTTTTCTTGGG + Intronic
1082758182 11:57098823-57098845 TTTATGACTTAACTTCTCTCTGG - Intergenic
1084073998 11:66758096-66758118 ACTATGAGGTCATGTTTCTCTGG + Intronic
1084334697 11:68449887-68449909 ACTGTGCCTTCATTTTTCACTGG + Intergenic
1085497292 11:76981866-76981888 TATATGACTTCATTTCTCTTGGG + Intronic
1085997457 11:81937458-81937480 TGTAGGAATTCATATTTCTCAGG + Intergenic
1086802176 11:91190899-91190921 TCTGTGAACTCATTTTCCTCAGG + Intergenic
1087147013 11:94822448-94822470 TCTCTCACTTCATTTCTCTGTGG - Intronic
1087437383 11:98138786-98138808 TCACTGACTTCATATTTCTGAGG + Intergenic
1087778212 11:102275927-102275949 TTTAAAACTTCAGTTTTCTCTGG - Intergenic
1088236239 11:107727269-107727291 GCAATGACTCCATTGTTCTCTGG + Intergenic
1088515796 11:110632167-110632189 TCTATGTTTTCATTTCTCTTGGG + Intronic
1089529599 11:119117934-119117956 TCTATGACTACCTATATCTCAGG + Exonic
1089888190 11:121850879-121850901 TCTCTCTCTCCATTTTTCTCTGG + Intergenic
1091171187 11:133521039-133521061 TCTGTGACTTCCTCTCTCTCTGG - Intronic
1092533284 12:9362972-9362994 TCTATCCCTCCATTTTTCTTGGG + Intergenic
1092712889 12:11356320-11356342 ACTATGTATTCAGTTTTCTCAGG - Intronic
1092716684 12:11396296-11396318 ACTATGTATTCAGTTTTCTCAGG - Intronic
1092909299 12:13132322-13132344 TCTATCCTTTCATTTCTCTCAGG - Intronic
1093102356 12:15042349-15042371 TCTAAGACTTCATGTTTATTTGG + Intergenic
1093277423 12:17147254-17147276 TATATCATTTCATTTTCCTCTGG - Intergenic
1094382906 12:29863050-29863072 TCTGTCACTACATTTCTCTCTGG + Intergenic
1094478126 12:30857909-30857931 TGTATGACTTTTTTTTTTTCGGG - Intergenic
1094730781 12:33172339-33172361 TCTATAACATCTTTTTTCCCGGG - Intergenic
1096124455 12:49109511-49109533 TCATTCCCTTCATTTTTCTCAGG - Intronic
1098095360 12:66948827-66948849 TCTACAGCTTCATTTTTCTGTGG - Intergenic
1099753730 12:86812712-86812734 TGTATGTCTTCACTTTTCTTAGG + Intronic
1100001309 12:89839501-89839523 TCCTTGTGTTCATTTTTCTCAGG - Intergenic
1100277749 12:93086825-93086847 TCCCTGACTTCTTTTTTCTGAGG - Intergenic
1100688699 12:97014941-97014963 TCATTGGCTTCATTTTCCTCTGG - Intergenic
1100828381 12:98495785-98495807 CATATGTCTTCATTTCTCTCAGG + Intronic
1101720835 12:107349268-107349290 TCTATAACATCATTGTTCTCTGG + Intronic
1102731682 12:115116820-115116842 GTTATGACTTCATATTTTTCTGG - Intergenic
1103518908 12:121524831-121524853 TCTATGACTGCATCTGTCCCTGG - Intronic
1105340005 13:19513664-19513686 CCTGGTACTTCATTTTTCTCTGG + Intronic
1105508414 13:21031094-21031116 TATGTAACATCATTTTTCTCTGG + Intronic
1105841127 13:24254456-24254478 TCTGTAACTTCATTTTTATTTGG + Intronic
1107009183 13:35651052-35651074 TATATGACTGTATTATTCTCAGG + Intronic
1107756671 13:43631200-43631222 TCTTTGAGTTTATTTTCCTCAGG + Intronic
1108151745 13:47543016-47543038 TCTATGTCCTCATAGTTCTCTGG + Intergenic
1108806447 13:54162451-54162473 TCTCTGCCTTCATTTTTATATGG + Intergenic
1109462669 13:62682478-62682500 TACATGACTTCATTTTTATATGG - Intergenic
1109658092 13:65420690-65420712 CCTCTGACTCCATTTTTCCCTGG - Intergenic
1110283039 13:73717961-73717983 TGAATGACTTCCTTTTTTTCAGG - Intronic
1110383659 13:74883141-74883163 TCCATGACTTCATTTATCCAGGG - Intergenic
1110492785 13:76128407-76128429 TCTATGAATTGCTTTTTTTCTGG + Intergenic
1110494575 13:76151552-76151574 TCATTCACTTTATTTTTCTCTGG + Intergenic
1111011135 13:82316704-82316726 GCTATGACTCCATTTCTTTCTGG + Intergenic
1111337477 13:86841251-86841273 TCTATGAATTCAGCTTTCTTAGG + Intergenic
1111337615 13:86842714-86842736 TCTATGAGTTCAGTTTTCTTTGG + Intergenic
1111605934 13:90539093-90539115 TCCATGAGTACATATTTCTCAGG - Intergenic
1111987030 13:95076409-95076431 TGTGTGACTTCTTTTTTCTTTGG + Intronic
1112375197 13:98833259-98833281 TCTATGAATGCCATTTTCTCAGG + Intronic
1112566773 13:100558652-100558674 TATATGAGTTCATTTATCTTGGG - Intronic
1112682393 13:101781916-101781938 ACTATGCTTTCATTTTTCTCTGG + Intronic
1113132832 13:107057203-107057225 TCTATGAGTTCATAGTTCACTGG - Intergenic
1114058050 14:18992112-18992134 TCTTTTTCTTCATTTTTCTCTGG - Intronic
1114104498 14:19409642-19409664 TCTTTTTCTTCATTTTTCTCTGG + Intronic
1114814038 14:25935430-25935452 TTTACAAATTCATTTTTCTCTGG + Intergenic
1115601496 14:34959963-34959985 TCTTTGAAATCAATTTTCTCTGG - Intergenic
1115819963 14:37203620-37203642 TCTATGACTTCCCTTTTTGCTGG + Intronic
1116606480 14:47003291-47003313 CTTATGGCTTCATTTTTCACTGG + Intronic
1116725141 14:48553813-48553835 TCTAGGACTTGACTTTTGTCTGG - Intergenic
1116781458 14:49241693-49241715 TCTGTGACTCCCTTTTTCACTGG - Intergenic
1117612221 14:57496210-57496232 TCTCTTAGTACATTTTTCTCTGG - Intergenic
1118225783 14:63897833-63897855 CATCTGACTTCATTTTTCTCAGG - Intronic
1118337935 14:64870312-64870334 TCTCTGACTTTTTTTTTTTCAGG - Intronic
1118559206 14:67060248-67060270 CATATGACAGCATTTTTCTCTGG - Intronic
1119014238 14:71032677-71032699 TCTAATCCTTCATTGTTCTCTGG - Intronic
1120646961 14:87085720-87085742 TGTTTCACTTGATTTTTCTCAGG - Intergenic
1121411830 14:93753561-93753583 TCTATGGCCTTATTTTTCTCTGG + Intronic
1121789574 14:96688999-96689021 TTTATGACTTCCTTCTTCACTGG + Intergenic
1121925815 14:97926345-97926367 TCTCTGACTTAATTCATCTCTGG - Exonic
1123541036 15:21291758-21291780 TTCTTGATTTCATTTTTCTCTGG - Intergenic
1124864418 15:33474985-33475007 TCTTTGACTTGATTTTCCTAAGG + Intronic
1125022916 15:35002708-35002730 TCTGTGTTTTCATTTTTCACTGG + Intergenic
1125140499 15:36400814-36400836 TCCCTGATTTTATTTTTCTCAGG - Intergenic
1126682411 15:51215318-51215340 TCTATGATTTCATTTTGTTGAGG - Intronic
1126801407 15:52300726-52300748 TATATGTCTTCATTTCTCTTGGG + Intergenic
1127385884 15:58466500-58466522 TCTATGGCTTCTTTATTCTAAGG + Intronic
1127517210 15:59707640-59707662 TCTATGTCTTTGTTTTTCTTGGG + Intergenic
1127867863 15:63046645-63046667 TCGAAGACTCCATTTTTTTCTGG + Intronic
1128190021 15:65684202-65684224 TCTATGTTTTCATTTCTCTTGGG + Intronic
1129301524 15:74628387-74628409 GCTGTGACTACATTTCTCTCTGG - Intronic
1129962653 15:79701771-79701793 ATTCTGACTTAATTTTTCTCAGG + Intergenic
1131056965 15:89380718-89380740 TCCCTGACTTCAGTTTTCTAGGG + Intergenic
1202949349 15_KI270727v1_random:18899-18921 TTCTTGATTTCATTTTTCTCTGG - Intergenic
1133437573 16:5793129-5793151 TCCATGACTCCCTTTCTCTCTGG + Intergenic
1134381914 16:13735444-13735466 ACTATGTCTTCATTTTTCTTGGG + Intergenic
1135711586 16:24721906-24721928 AGTATGACTTCATTTTTATGAGG + Intergenic
1135992446 16:27226461-27226483 TCGCTTACTTTATTTTTCTCAGG - Intronic
1136034974 16:27532286-27532308 TCTCTGATTTCATTGTTCACAGG - Intronic
1137819890 16:51434188-51434210 TCAATGACTTCAGTTCCCTCTGG + Intergenic
1138705157 16:58908112-58908134 TCTATCCCTTCTTTTATCTCAGG - Intergenic
1138838191 16:60464065-60464087 TCTGTGACTTTATTTTCCCCTGG + Intergenic
1140317636 16:73914436-73914458 TCTGTGACTGCGTTTTTTTCCGG - Intergenic
1140787033 16:78352170-78352192 TCTCTGTCTTCATTTTTCACAGG + Intronic
1140968111 16:79987014-79987036 TCTATTGCTTCAATTTTCTTTGG - Intergenic
1141750785 16:85956529-85956551 TGTCTGACTTTATTTTTCTTGGG + Intergenic
1144525757 17:15988716-15988738 TATAAGACTTCTATTTTCTCAGG + Intronic
1146607035 17:34269754-34269776 TCTATTATTTTACTTTTCTCTGG + Intergenic
1146960483 17:36971583-36971605 TGTATGTCTTCATTTTTCTAGGG - Intronic
1147328394 17:39681461-39681483 TGAGTGACTTCATTTTTGTCTGG - Intronic
1147718754 17:42525191-42525213 GGTATGATTTCATTTTTCTTGGG - Intergenic
1149048929 17:52281441-52281463 TCTTTTCTTTCATTTTTCTCAGG - Intergenic
1149513928 17:57265712-57265734 TCTATATCTTCGTATTTCTCTGG + Intronic
1149650651 17:58274199-58274221 TCCATGTCTTCACTTTTCACAGG - Intronic
1149729290 17:58928656-58928678 TATATGTTTTCATTTTTCTTGGG - Intronic
1150381548 17:64724298-64724320 TTTATGAATTCATTTTTCAGGGG + Intergenic
1150420701 17:65032788-65032810 TCTATGACTTCATTTTTCTCTGG + Intronic
1151030759 17:70735294-70735316 TCTGTGACTTCATTCTACGCTGG + Intergenic
1152490421 17:80628527-80628549 TATTTTGCTTCATTTTTCTCTGG + Intronic
1153150435 18:2086628-2086650 ACTATTACATCATTTTTCTTTGG + Intergenic
1153404614 18:4722722-4722744 TCTTTGACTTCAGTTTGCCCAGG + Intergenic
1153584386 18:6606274-6606296 TCTATGACTTCAGATGTCTTTGG - Intergenic
1156566804 18:38200700-38200722 TCTTTTTCTTAATTTTTCTCGGG - Intergenic
1156609439 18:38708966-38708988 TCTATAACCACATTTTTCTGGGG + Intergenic
1156642626 18:39120424-39120446 AGTTGGACTTCATTTTTCTCTGG - Intergenic
1157195603 18:45617938-45617960 CCTAAGCCTTCATTTTTCTAGGG - Intronic
1157212207 18:45753196-45753218 TCTATGTCTTCTTTTATCTGGGG + Intergenic
1157287731 18:46388620-46388642 TCTGTGACTTCTTTTCACTCGGG + Intronic
1157654078 18:49368447-49368469 TCCATGCTTTCTTTTTTCTCTGG + Intronic
1157861640 18:51146271-51146293 TCTGTGACTTCATTTTTTTTTGG + Intergenic
1158117965 18:54017808-54017830 TATGTGACACCATTTTTCTCTGG + Intergenic
1160043757 18:75368533-75368555 TCTCTGCCTTCATTTTCCCCTGG - Intergenic
1160047743 18:75402798-75402820 TGTAACACCTCATTTTTCTCTGG - Intergenic
1160322669 18:77911090-77911112 GATATGACTTCATTTTTCCCGGG + Intergenic
1160570236 18:79811728-79811750 TCTATTCCTTCATTTGTTTCAGG - Intergenic
1161544052 19:4869027-4869049 TCTGTGACTGCATTTTTTTGGGG + Intergenic
1162144260 19:8603963-8603985 TTTATGATTTCATTCTTATCAGG + Intronic
1163001657 19:14372082-14372104 TGTCTGCCTTCAGTTTTCTCAGG + Intergenic
1163064669 19:14784277-14784299 TGTCTGCCTTCAGTTTTCTCAGG - Intergenic
1165142384 19:33707741-33707763 CCTATGTTTTCATTTTTCTTGGG + Intronic
1165753743 19:38278946-38278968 TTCATGACTTCAGTTCTCTCAGG + Intronic
1166635509 19:44448117-44448139 TCGATGACATGAATTTTCTCAGG - Intronic
1167262010 19:48464006-48464028 TCTCTGACTTCCTCTCTCTCTGG + Intronic
1167315649 19:48761439-48761461 TCTCTGTCTTCCTTTTTCCCTGG - Intergenic
1167315682 19:48761601-48761623 TCTCTGTCTTCCTTTTTCCCTGG - Intergenic
1167315702 19:48761697-48761719 TCTCTGTCTTCCTTTTTCCCTGG - Intergenic
1167315756 19:48761930-48761952 TCTCTGTCTTCCTTTTTCCCTGG - Intergenic
1168126203 19:54285048-54285070 TCCATGTCCTCATGTTTCTCAGG - Intergenic
1168175740 19:54626025-54626047 TCCATGTCCTCATGTTTCTCAGG + Intronic
1168557814 19:57358149-57358171 TCAATCACTCCATTTTGCTCAGG + Exonic
925002077 2:411315-411337 TGTATGATTTCATTTGTCTGAGG - Intergenic
925009760 2:474377-474399 TCTCTCTCTTCATCTTTCTCTGG - Intergenic
929377805 2:41311190-41311212 AATATGACTTCATTTTTCTTGGG + Intergenic
929527931 2:42723384-42723406 TCTAAGACATCAGTGTTCTCTGG + Intronic
930905521 2:56561956-56561978 TCTATGAGTTCAATTTTCCCTGG + Intergenic
931569551 2:63653967-63653989 TCTATCAACTGATTTTTCTCTGG - Intronic
933540891 2:83640791-83640813 TATTTGACATCATTTGTCTCTGG - Intergenic
934528819 2:95072336-95072358 TCTATGACTGTAATTTTCTAGGG - Intergenic
934788996 2:97041172-97041194 GCTATCACTACATTGTTCTCTGG + Intergenic
934817478 2:97341388-97341410 GCTATCACTACATTGTTCTCTGG - Intergenic
934820218 2:97367096-97367118 GCTATCACTACATTGTTCTCTGG + Intergenic
936121522 2:109750031-109750053 TGTATGACATCAGTTTTTTCTGG - Intergenic
936223175 2:110621437-110621459 TGTATGACATCAGTTTTTTCTGG + Intergenic
936246659 2:110834441-110834463 TCAATGAATACATTTTTCTTAGG - Intronic
936679593 2:114754739-114754761 TCTAAGCATTGATTTTTCTCAGG + Intronic
937513205 2:122621958-122621980 TCTATTATTCCATTTTTGTCTGG + Intergenic
938366906 2:130741811-130741833 GATATTACTTCATTTTTTTCTGG - Intergenic
938704314 2:133908062-133908084 TCTTTGAATTCATTCTTCTTTGG - Intergenic
939305368 2:140403270-140403292 TCAATGATTTCATCTTTTTCTGG - Intronic
939977473 2:148735436-148735458 TCTTTGGGTCCATTTTTCTCTGG + Intronic
940217635 2:151316565-151316587 ACTTGGACTTCATCTTTCTCTGG - Intergenic
940233720 2:151486506-151486528 CCTATGTCTTCATTCTTCTTGGG - Intronic
940411863 2:153373833-153373855 TATATGATTTCATTTATCTGAGG - Intergenic
942144759 2:173015907-173015929 TTTTTTAGTTCATTTTTCTCAGG - Intronic
943482548 2:188439165-188439187 TCTCTGAATTTACTTTTCTCTGG - Intronic
944103639 2:196055659-196055681 TCTATAACTGCATTCTTCTCAGG - Intronic
944734151 2:202546432-202546454 TCTATGCTTTCATTTTTATCAGG - Intronic
944959434 2:204854391-204854413 TAGATTCCTTCATTTTTCTCAGG - Intronic
947064173 2:226201421-226201443 TCTCTGACTTCACTTTAATCTGG + Intergenic
947899598 2:233710249-233710271 TCTGAGATTTCATTTTTCTTGGG + Intronic
1170331354 20:15214180-15214202 AGTATGACTTTATTTTTCTCTGG + Intronic
1170620922 20:17995176-17995198 TTTATGACGGCATTTGTCTCAGG - Intronic
1170674783 20:18468638-18468660 GCTGAGACTTCAGTTTTCTCGGG - Intronic
1172744890 20:37199248-37199270 TCTCAGGCTTCATTTGTCTCGGG + Intronic
1172794049 20:37525003-37525025 TCTGAGACTTCATCTTTCTTAGG + Intronic
1173415331 20:42850028-42850050 CCTATGACTACATTTCTCCCTGG + Intronic
1173680217 20:44874105-44874127 CCTATGACCTCAATTTTCTGAGG - Intergenic
1174723403 20:52837275-52837297 TCAATGTCATTATTTTTCTCTGG - Intergenic
1174839465 20:53887895-53887917 TCTATGATTCCATTTTTATGAGG - Intergenic
1175425628 20:58864071-58864093 TCTGTGCCTCCATTTTTCTAGGG + Intronic
1175942644 20:62545012-62545034 TTTATGACTTCATTTTTCAAGGG + Intergenic
1178514369 21:33233907-33233929 TCTCTGACTTCTTTTTTTTTTGG - Intronic
1179185297 21:39081221-39081243 TCTATGTCTTCCTTTTTTTGAGG + Intergenic
1180202284 21:46231498-46231520 ATTATGACTTCATATTCCTCTGG - Intergenic
1180476535 22:15714728-15714750 TCTTTTTCTTCATTTTTCTCTGG - Intronic
1180944631 22:19684887-19684909 TCTATGTCTTTTTTTTTCTTTGG - Intergenic
1181676804 22:24459897-24459919 TCTCTCAATACATTTTTCTCAGG - Intergenic
1181794526 22:25295457-25295479 TATATGGTTTCATTTCTCTCAGG + Intergenic
1181834507 22:25591966-25591988 TATATGCTTTCATTTCTCTCAGG + Intronic
1182514465 22:30846035-30846057 TATATGTTTTCATTTTTCTTGGG + Intronic
1182884164 22:33759087-33759109 TCTCTGCCTTGGTTTTTCTCAGG - Intronic
1183473733 22:38024174-38024196 TATATGATTCCATTTTTCTGAGG - Intronic
1183846938 22:40549476-40549498 TGTATGACTCCATTTTTATAAGG + Intronic
1184065403 22:42116403-42116425 TCTTTGTTTTCACTTTTCTCTGG + Intergenic
1185124232 22:48996813-48996835 TCTATGATTTCATTTATATATGG - Intergenic
949804991 3:7944934-7944956 TCTATGAATTCCATCTTCTCTGG + Intergenic
950465891 3:13153474-13153496 TCTATGAGTGCACTTTGCTCTGG - Intergenic
950795316 3:15505840-15505862 TCCATGCCTTCATTTTTCCATGG + Intronic
951057385 3:18163375-18163397 TCTTTGCCTTCTTTTTCCTCAGG + Intronic
951130786 3:19041442-19041464 CCTATGCTTTTATTTTTCTCAGG - Intergenic
952079062 3:29735283-29735305 GAAATGACTTCCTTTTTCTCAGG - Intronic
952531472 3:34266554-34266576 TCTTGGAATTCATTTTCCTCAGG + Intergenic
953467814 3:43139571-43139593 TCTCTGACTTCATTTTGGTTAGG - Intergenic
954909924 3:54095873-54095895 TTTCTGACTTCACTTATCTCTGG + Intergenic
955574843 3:60349681-60349703 TCTTTGAATTGCTTTTTCTCAGG - Intronic
955978940 3:64505400-64505422 TTTATGGCTCCATTTTTCTATGG - Intergenic
956128827 3:66036550-66036572 TTTATGACTTCATTCTCCACTGG - Intronic
956209918 3:66792003-66792025 GCTCTGTCTCCATTTTTCTCTGG - Intergenic
957503270 3:81085742-81085764 TCTATGTTTTAATTTTTCTAGGG + Intergenic
957809011 3:85193210-85193232 TGTCTGACTTCATTTTTAACTGG + Intronic
957843682 3:85702902-85702924 TTTATGACTTCACTTCTTTCTGG + Intronic
958176651 3:90003757-90003779 TCTACTACTTCATTTTTCACAGG + Intergenic
958842849 3:99229195-99229217 TCTATGAGTTGATTTTTTTTGGG + Intergenic
959099018 3:101989443-101989465 TCTATGCTTTCTTTTTTCCCTGG + Intergenic
959412203 3:106038237-106038259 TCTCTTACTATATTTTTCTCAGG - Intergenic
959570653 3:107879944-107879966 CATATGCCTTCATTTCTCTCGGG + Intergenic
959855662 3:111154485-111154507 TATATGCTTTCATTTTTCTTGGG + Intronic
960106489 3:113803178-113803200 TGTATGATTTCATTTTTATGTGG + Intronic
962839711 3:139222353-139222375 TCTGTGACCTGGTTTTTCTCAGG + Intronic
963574084 3:147037381-147037403 TCTTTGACTTCTTTTTTTTTTGG - Intergenic
963589052 3:147233534-147233556 TCTTCTACTTCTTTTTTCTCTGG - Intergenic
964025402 3:152067594-152067616 TGTATGCTTTCATTTATCTCAGG + Intergenic
964249826 3:154700098-154700120 TCTCTGACATCATTCTTCACAGG - Intergenic
964279450 3:155047567-155047589 TCTCTCATTTCATTTTTTTCAGG + Intronic
964360538 3:155891466-155891488 TCTGTGATTTCACTTTTCTACGG + Intronic
964823220 3:160796485-160796507 TCTATGTGTACATTCTTCTCAGG - Intronic
964924834 3:161942971-161942993 TGTCTGACTTCAGTTTTCTGGGG - Intergenic
965129145 3:164672139-164672161 TCTTTGACTTTATGTTTTTCAGG + Intergenic
965437863 3:168674777-168674799 TCTCTGACTTCATTATTATGTGG + Intergenic
965651814 3:170942105-170942127 TATATAATTTCATTTTTCTTGGG - Intergenic
965860500 3:173143652-173143674 TTTATGACTTAATTTTTGTGTGG + Intergenic
966022762 3:175236139-175236161 TCTATGACTCCTTTATACTCCGG + Intronic
966090706 3:176132354-176132376 TCTCTGACTTGAATTTTATCAGG + Intergenic
967225812 3:187290083-187290105 TCTATGTCTTCATCTTTGTATGG - Intronic
967666904 3:192183511-192183533 TCTCTGTCTTCATTCTTCTTTGG - Intronic
967811292 3:193763120-193763142 TTTATATCTTCATTTTTCTTTGG + Intergenic
968208910 3:196830289-196830311 TTCTTGATTTCATTTTTCTCTGG + Exonic
968897308 4:3412268-3412290 TCTAGGGCTCCACTTTTCTCTGG + Intronic
971311216 4:25527178-25527200 TGTATGACTTCACTCTTGTCTGG - Intergenic
971670755 4:29553728-29553750 TCTCAGATTTCATTTTTTTCTGG + Intergenic
971752433 4:30667676-30667698 CCTCTGACTTCATTTTCTTCAGG + Intergenic
972767516 4:42165587-42165609 TCTAAGTCTTCCTGTTTCTCAGG - Intergenic
974085222 4:57253247-57253269 ACTTTAACTTCATTTTTCTTTGG + Intergenic
974102848 4:57436900-57436922 TCCATGACTTCTGTTTCCTCAGG - Intergenic
974112657 4:57543606-57543628 TCTATCACTTCTTTTCTCTCTGG - Intergenic
974787754 4:66642668-66642690 TCTAGTACTTCCTTTTTTTCTGG - Intergenic
975122113 4:70739756-70739778 TCTTGTACTTCTTTTTTCTCTGG - Intronic
976019597 4:80605299-80605321 TCTATGACTTTATTTTCCAAAGG + Intronic
976237340 4:82912444-82912466 TCTAGGACTATATTTTTCCCAGG + Intronic
977466865 4:97393451-97393473 TCTGTGAGGTCATTTTTTTCTGG - Intronic
978515579 4:109565160-109565182 TCTCTACCTTCATTTTCCTCTGG - Intronic
978607788 4:110501240-110501262 TCTATGACCTGATTTTTTTATGG + Intronic
978767169 4:112415899-112415921 TTTTTTACTTCATTTTTCTAAGG - Intronic
980798690 4:137718840-137718862 TCTTTGATTTCTTTTTTCCCAGG - Intergenic
981111245 4:140936267-140936289 TATATGCATTCATTTCTCTCAGG + Intronic
981602710 4:146508718-146508740 TCTCTGAGTTGATTTCTCTCAGG + Intronic
981613635 4:146623073-146623095 TCAAAGACTTTCTTTTTCTCAGG - Intergenic
981621286 4:146701999-146702021 TGTATGATTTTATTTTTCTTTGG + Intergenic
982841877 4:160198596-160198618 TCTTTCTCTTCATTTTTTTCTGG + Intergenic
983309810 4:166045113-166045135 TCTATGACATGACTTTTCCCAGG - Intronic
983375250 4:166918931-166918953 TCTCTGTCTTGATTTCTCTCTGG + Intronic
984331898 4:178332348-178332370 TGTTTGCCTTGATTTTTCTCAGG - Intergenic
984511655 4:180685844-180685866 TCTATTTCCTCATTTCTCTCTGG - Intergenic
984639942 4:182151639-182151661 TCTATGACTTTTTTTCTCTTAGG + Intronic
984832331 4:183987179-183987201 TCTCTGACTCCATTTTTCTCGGG + Intronic
986786853 5:11122807-11122829 TATGTGACTTCATTTTTCGACGG - Intronic
987117806 5:14739872-14739894 TCTGTGACTTGAAGTTTCTCAGG - Intronic
987389164 5:17360015-17360037 TTTCTGACATCACTTTTCTCTGG + Intergenic
987758131 5:22123545-22123567 TCTTTCAATTCCTTTTTCTCTGG - Intronic
988050480 5:26023209-26023231 TCTGTGCCCACATTTTTCTCAGG - Intergenic
989819508 5:45778509-45778531 TGTATGATTTCATTTATGTCAGG + Intergenic
989994910 5:50818186-50818208 ACTATGACTTCTTTTTTTTGGGG - Intronic
990396422 5:55384836-55384858 TCTGTGACTTTACCTTTCTCTGG + Intronic
991412951 5:66362914-66362936 ACTATGCAGTCATTTTTCTCTGG + Intergenic
991556563 5:67901506-67901528 TCTCTTTCCTCATTTTTCTCTGG - Intergenic
992701506 5:79345845-79345867 TATATAACTTCATTTTTGGCAGG - Intergenic
992998070 5:82351912-82351934 TGTAGGCCTTCATTTTTCACCGG + Intronic
993204324 5:84860997-84861019 TCTGTGACTGCAGCTTTCTCCGG + Intergenic
994641388 5:102414093-102414115 TTTATCAATTCATTTTTTTCTGG + Intronic
994641544 5:102416213-102416235 TATATTATTTTATTTTTCTCTGG - Intronic
994909270 5:105881866-105881888 TCTATGAATTCATTTCTCTGTGG + Intergenic
995179407 5:109216623-109216645 TATATGTTTTCATTTTTCTTGGG - Intergenic
995758249 5:115535750-115535772 TATATGTTTTCATTTCTCTCAGG - Intronic
996197926 5:120632440-120632462 TATTTGACTTCACCTTTCTCTGG - Intronic
996920267 5:128760261-128760283 GATATGACCTCATTTTTTTCTGG - Intronic
997230978 5:132242934-132242956 AGTAGGACTTCACTTTTCTCTGG + Intronic
997347496 5:133202528-133202550 ACTGGGAGTTCATTTTTCTCTGG + Intronic
998611024 5:143688419-143688441 TCTTTGACCTAATGTTTCTCTGG + Intergenic
998858371 5:146418198-146418220 GCTATGCTTTCATTTTTCTTGGG - Intergenic
999070807 5:148741633-148741655 TTAATGACTTTATTTTTATCCGG - Intergenic
1003701937 6:8476167-8476189 TATATGAGTTCATTTTTGTGAGG + Intergenic
1003797660 6:9623090-9623112 TCTTTGTCTCCATTTTCCTCTGG - Intronic
1003989479 6:11471523-11471545 TCAATGAGTTCAATTGTCTCTGG - Intergenic
1005358954 6:25012381-25012403 TATATGTTTTCATTTTTCTTGGG - Intronic
1006851033 6:37098766-37098788 TCTAGGACAGCTTTTTTCTCAGG - Intergenic
1007891368 6:45295985-45296007 CCTATGACTTTTTTTTCCTCTGG - Intronic
1008743493 6:54639548-54639570 TATCTGACTCCATTTTGCTCTGG + Intergenic
1008791980 6:55246690-55246712 TCTAGTACTTAATTTTTCTTAGG + Intronic
1008816500 6:55573811-55573833 TCTATGACTTGATGTTTGTTGGG - Intronic
1009041605 6:58186291-58186313 TCTTTGATTTCATGTTTTTCTGG + Intergenic
1009722441 6:67489694-67489716 TTTATGAATTCATTATTTTCTGG - Intergenic
1009858142 6:69290632-69290654 TCTATCACATAGTTTTTCTCTGG + Intronic
1010215375 6:73396367-73396389 TCCATCTATTCATTTTTCTCAGG - Intronic
1010546849 6:77169576-77169598 TCAATAACTTCATTTTGCTTAGG + Intergenic
1010735671 6:79441511-79441533 TTTTTAATTTCATTTTTCTCTGG - Intergenic
1010965993 6:82209226-82209248 CCTATGTTTTCATTTTTCTTGGG - Intronic
1011003206 6:82614805-82614827 TCTCTCATTTCCTTTTTCTCGGG - Intergenic
1011272285 6:85592317-85592339 TTGGTAACTTCATTTTTCTCTGG - Intronic
1011542248 6:88443574-88443596 TGTATGTCTTCATTTATCTTGGG + Intergenic
1012241547 6:96878638-96878660 TCTGTGACTTCAGTTTCTTCTGG + Intergenic
1013280204 6:108629047-108629069 TCTCTGCCTCCATTTTTCACAGG + Intronic
1013730718 6:113162985-113163007 TCTGTGAATTCATTTTTATTGGG - Intergenic
1014236844 6:118967432-118967454 TGTATGACGTCATTTTTTCCTGG + Intronic
1015099908 6:129464803-129464825 TCTTTGGCCTCATTTTTTTCTGG + Intronic
1016122208 6:140358060-140358082 TATATGCCTTCATTTCTCTTGGG + Intergenic
1016368589 6:143345626-143345648 TTTATAACTCAATTTTTCTCTGG - Intergenic
1016872397 6:148831560-148831582 TATATGACTTCTTATTTGTCGGG - Intronic
1017228884 6:152051177-152051199 TTTCTGATTTCATTTTCCTCTGG + Intronic
1017730988 6:157315417-157315439 TCAGTGAGTTCATTTTTCTGTGG + Intronic
1017746395 6:157450552-157450574 TCTCTGTCTTCATTTTTGTTTGG + Intronic
1018087392 6:160315343-160315365 TCTTTGTCTTTATTTTTCTTGGG - Intergenic
1018354437 6:162998008-162998030 TCTCTGGCTTTAGTTTTCTCAGG + Intronic
1018602148 6:165555856-165555878 TCTTTGACTTCACATTCCTCTGG - Intronic
1019846219 7:3504914-3504936 TTTATGTTTTCATTTTTCTTGGG - Intronic
1020384617 7:7585514-7585536 TCTCTGAGCTCATTTTTCTGAGG + Intronic
1020674069 7:11158724-11158746 TCTATGACTTGATGTCTCTAAGG + Intronic
1021019122 7:15574596-15574618 TATATGATTTCACTTTTCTTGGG - Intergenic
1021030040 7:15721472-15721494 TTTATGACTTCCTGTTTCACTGG + Intergenic
1021056686 7:16057043-16057065 TGTATGTTTTCATTTTTCTTGGG - Intergenic
1021700635 7:23316268-23316290 TCTTTGACTTCTATTTTCTCTGG - Intronic
1021920790 7:25482873-25482895 ACTATGATCTCATTTTTTTCTGG - Intergenic
1022947274 7:35299653-35299675 TCTTTTACTTAATTTTTCTGAGG + Intergenic
1024300939 7:47887164-47887186 TCTATGTCTTCATGTATCTGTGG + Intronic
1024665498 7:51543294-51543316 TATTGGACTTCACTTTTCTCTGG + Intergenic
1024723793 7:52169350-52169372 TCCATGACCTAAGTTTTCTCTGG - Intergenic
1027392152 7:77715295-77715317 TGTATGTTTTCATTTTTCTTGGG + Intronic
1028108536 7:86910000-86910022 TTTATGACTTTATTTTCCTAGGG - Exonic
1028904199 7:96134966-96134988 TCCATTTCTTCCTTTTTCTCAGG - Intronic
1029342430 7:99956064-99956086 TCCAGGACTTCAGTTTTCTGAGG - Intergenic
1031385391 7:121143814-121143836 CATATGACTTCATTTATCTTAGG - Intronic
1031832598 7:126645920-126645942 TGTATGACTTCTATTTTCCCTGG - Intronic
1031898872 7:127388078-127388100 TCTCTGATTTCTCTTTTCTCAGG + Intronic
1032216085 7:129958418-129958440 TATAAGACATCTTTTTTCTCTGG + Intergenic
1032303664 7:130712909-130712931 CCTATTAGTTCCTTTTTCTCTGG + Intergenic
1032813637 7:135448591-135448613 CCTTTGCCTTTATTTTTCTCTGG - Intronic
1032815484 7:135469727-135469749 TGTATGTTTTCATTTTTCTTGGG - Intronic
1033994902 7:147333210-147333232 ACTATGCCTTCTGTTTTCTCTGG - Intronic
1034852642 7:154509632-154509654 TATATGTTTTCATTTTTCTTGGG - Intronic
1036517954 8:9462648-9462670 TCTATAATTGTATTTTTCTCTGG - Intergenic
1037421772 8:18709988-18710010 TCTATCACTTCATCTGTCTCAGG - Intronic
1038069779 8:24001378-24001400 TTTATTTCTTCATTTTTCTGAGG + Intergenic
1039409710 8:37342456-37342478 TTTATGAATTCATTATTTTCTGG + Intergenic
1040351031 8:46568450-46568472 TCTATGAGTGCATTGTTCCCTGG - Intergenic
1040365965 8:46716238-46716260 TCTATGTGTGCATTTTTCCCTGG + Intergenic
1040949505 8:52922722-52922744 TATCTGAGTTCATTTTTTTCGGG - Intergenic
1041048572 8:53910591-53910613 TGTATGTTTTCATTTTTCTTGGG - Intronic
1041199185 8:55434062-55434084 TCTTGAACTTGATTTTTCTCTGG - Intronic
1041263219 8:56039478-56039500 TCTATGCCTTCACTTGACTCTGG - Intergenic
1041436052 8:57842834-57842856 TCTATGACTGCATCTGTGTCAGG - Intergenic
1041782140 8:61588768-61588790 TTTATGTTTTCATTTTTCTTGGG - Intronic
1041883813 8:62785116-62785138 TTTATGTCTTCATTTTTCTTGGG - Intronic
1041896873 8:62935056-62935078 TCTATGACTTGTTTTTATTCTGG - Intronic
1041935015 8:63324256-63324278 CCTATGCCTTCATTTCTCCCTGG - Intergenic
1042824847 8:72969723-72969745 TCTGTGACCTCAATTTTCTGAGG - Intergenic
1043157199 8:76798238-76798260 TCTTTGTTTTCATTTTTATCTGG + Intronic
1043376708 8:79657616-79657638 TCTAGGACCACATTTTTTTCTGG + Intronic
1043454707 8:80401842-80401864 TCAATGTCTTCAATTTTCTGGGG + Intergenic
1043534145 8:81182479-81182501 TGAATGACTTCATTTTTACCTGG + Intergenic
1043784572 8:84381810-84381832 TCTGTGACATTATTTTTCTTTGG + Intronic
1043951292 8:86311777-86311799 TGTGTGACCTCATTTTTCTTGGG + Intronic
1043980846 8:86637268-86637290 TCTATGTATTCATTTATTTCTGG + Intronic
1044202801 8:89456519-89456541 TATGTGAGTTCATTTTTATCAGG + Intergenic
1044953480 8:97455987-97456009 TCTCTGACCTCACTTTTCTTTGG + Intergenic
1045765204 8:105659283-105659305 TGTATGATTTCTTGTTTCTCAGG - Intronic
1046931777 8:119848621-119848643 TCTATGTTTTCATTTTTCTTGGG - Intronic
1047163754 8:122412462-122412484 TCAATGAATTCATTTTGGTCTGG + Intergenic
1048570186 8:135646482-135646504 AATATGACCTCATTTTTCACAGG - Intronic
1049951367 9:647424-647446 TCTATCACTTCATATCTCTTTGG + Intronic
1050132381 9:2426330-2426352 TCTATGACTTCAATATCCTATGG + Intergenic
1050259075 9:3822066-3822088 TGGGAGACTTCATTTTTCTCGGG - Intergenic
1050846373 9:10226057-10226079 CCTATGTCTTAATTTTGCTCTGG - Intronic
1051074429 9:13214076-13214098 TATATGTTTTCATTTTTCTTGGG - Intronic
1051162528 9:14224387-14224409 TCTACACCTTGATTTTTCTCAGG - Intronic
1051383908 9:16486239-16486261 CCTCTGACTTCATTTTCCTCTGG - Intronic
1052309633 9:27051652-27051674 TGTATGACTTCATTTATATGAGG - Intronic
1053284429 9:36841143-36841165 TCTCTGAATTCATTTCCCTCAGG + Intronic
1055043197 9:71897796-71897818 TCTACCACTTCCTTTTCCTCTGG + Intronic
1055351440 9:75393134-75393156 TCTTTTACTTCATATTTCTTAGG - Intergenic
1055458926 9:76498305-76498327 TATATGTTTTCATTTTTCTTGGG + Intronic
1055725514 9:79224080-79224102 CCCATGAGTTTATTTTTCTCTGG + Intergenic
1055933032 9:81579461-81579483 TATATGGCTTCATCTTGCTCAGG + Intergenic
1057094166 9:92290042-92290064 TCTATGTTTTCATTTCTCTTGGG + Intronic
1057587008 9:96337683-96337705 TTTAAGACTTCATTTTTGGCCGG + Intronic
1059615450 9:115945895-115945917 TCTATAATTTATTTTTTCTCAGG + Intergenic
1059718699 9:116937425-116937447 TTTGGGACTTCATTTTCCTCTGG + Intronic
1059840556 9:118210700-118210722 TCTAAGATTTTTTTTTTCTCAGG - Intergenic
1060187771 9:121574432-121574454 TCTCTTCCTTCATTTTTCTGAGG - Intronic
1060242722 9:121918293-121918315 TCTGTGACTTCTGGTTTCTCTGG - Intronic
1061685669 9:132275649-132275671 TCTACAACTTCATTTTTCACTGG - Intronic
1062127661 9:134872414-134872436 TATATGGTTTCATTTCTCTCGGG + Intergenic
1185689982 X:2146595-2146617 TCATTGACTTCATTTTTTACTGG - Intergenic
1186204657 X:7188644-7188666 TCTTTGTCTTCATTTCTCACTGG + Intergenic
1187264912 X:17722595-17722617 ACTAGGACTCCTTTTTTCTCAGG - Intronic
1187298395 X:18024934-18024956 TCTTTGACCTCATTTTCTTCTGG - Intergenic
1189172325 X:38921429-38921451 TTGATGACTTCATTTTTTTTAGG + Intergenic
1189879441 X:45473943-45473965 AGTATGACTTCATTTTTTTATGG + Intergenic
1191045448 X:56130718-56130740 GTTTGGACTTCATTTTTCTCTGG - Intergenic
1192405259 X:70878688-70878710 TTTATGTTTTCATTTTTCTTAGG - Intronic
1192405264 X:70878788-70878810 TTTATGTTTTCATTTTTCTTAGG - Intronic
1193096818 X:77558466-77558488 TCTGTGATGTCATCTTTCTCAGG - Intronic
1193585516 X:83317110-83317132 TTTATGATTTCATGTTCCTCTGG + Intergenic
1194233617 X:91355177-91355199 TCTATGTGTTCATTTTTTTTTGG - Intergenic
1194339127 X:92687679-92687701 TATATGTCTTCCTTTTGCTCCGG + Intergenic
1195332776 X:103818852-103818874 TTCATTACTTCATTTTTCTACGG + Intergenic
1195634055 X:107092866-107092888 TATATGCCTACATTTTTCTAAGG - Intronic
1195976880 X:110536294-110536316 TCTTTGAGATCATTTCTCTCTGG - Intergenic
1196059644 X:111393997-111394019 TACATGTCTTCATTTATCTCGGG - Intronic
1196730178 X:118933571-118933593 TCCATCACTTTATTTTTCACTGG + Intergenic
1197274903 X:124466952-124466974 ACTATGGCTTCAATTTCCTCGGG + Intronic
1197371414 X:125630131-125630153 ACTAGGACTCCATTTTTATCTGG - Intergenic
1197494135 X:127156017-127156039 TCTTTGAATTCATTTTACTTGGG + Intergenic
1197711115 X:129668677-129668699 TGTATGTCTTCAATTCTCTCAGG + Intergenic
1198303595 X:135356151-135356173 TGTATGTTTTCATTTTTCTTGGG + Intronic
1198646969 X:138819007-138819029 TCTAGGACTTCATTCTTCAGAGG + Intronic
1198761191 X:140034155-140034177 TCCATGATTTCATTTTATTCTGG + Intergenic
1198764508 X:140066886-140066908 TGTATTTTTTCATTTTTCTCTGG + Intergenic
1199617217 X:149666592-149666614 CCTATGAGTTAATTTTTCTAAGG - Intergenic
1199625424 X:149736657-149736679 CCTATGAGTTAATTTTTCTAAGG + Intergenic
1200647517 Y:5804460-5804482 TATATGTCTTCCTTTTGCTCCGG + Intergenic
1201577324 Y:15475056-15475078 TCTTTGTCTTCATTTCTCACTGG + Intergenic
1201641477 Y:16182323-16182345 TCTAGGACTTCAGTTTTCAAAGG + Intergenic
1201661338 Y:16402999-16403021 TCTAGGACTTCAGTTTTCAAAGG - Intergenic