ID: 1150423612

View in Genome Browser
Species Human (GRCh38)
Location 17:65058952-65058974
Sequence AAGAAGAAGAAGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150423609_1150423612 -4 Left 1150423609 17:65058933-65058955 CCTGAAAGTCAAATGAAGGAAGA No data
Right 1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG No data
1150423607_1150423612 5 Left 1150423607 17:65058924-65058946 CCTCTTTGACCTGAAAGTCAAAT No data
Right 1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150423612 Original CRISPR AAGAAGAAGAAGAAGGAGGA AGG Intergenic
No off target data available for this crispr