ID: 1150425104

View in Genome Browser
Species Human (GRCh38)
Location 17:65070960-65070982
Sequence CAGTATATGCAACTTTGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150425104_1150425106 12 Left 1150425104 17:65070960-65070982 CCAACACAAAGTTGCATATACTG No data
Right 1150425106 17:65070995-65071017 GGTGTGCTGATCATTGCTTCAGG No data
1150425104_1150425105 -9 Left 1150425104 17:65070960-65070982 CCAACACAAAGTTGCATATACTG No data
Right 1150425105 17:65070974-65070996 CATATACTGAGTTTTAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150425104 Original CRISPR CAGTATATGCAACTTTGTGT TGG (reversed) Intergenic
No off target data available for this crispr